previous page PLNT3140 Introductory Cytogenetics
Lecture 7, part 3 of 3
first page
    Undisplayed Graphic

Bluescript KS multiple cloning site (MCS)

A synthetic DNA sequence has been inserted downstream from the translation start site for the lacZ gene. Translation begins at position 788 with the ATG codon. The multiple cloning site, going from KpnI to SacI, is designed to have many convenient restriction sites, making it possible to clone a restriction fragment generated by almost any restriction enzyme somewhere in the MCS. The inserted fragment has a length divisible by 3, and sequences have been chosen so that there are no stop codons within the MCS. Although the lacZ protein will contain a few extra amino acids in its N-terminal region, these extra amino acids do not interfere with its enzymatic activity.

       m13 reverse primer: aacagct
       841       831       821         
GTGAGCGGATAACAATTTCACACAGGAAACAGCT 
CACTCGCCTATTGTTAAAGTGTGTCCTTTGTCGA

lacZ gene ---------------->                                               KpnI                  XhoI
atg acc atg---> 802                 787                 772                 757                 742 
ATG ACC ATG ATT ACG CCA AGC TCG AAA TTA ACC CTC ACT AAA GGG AAC AAA AGC TGG GTA CCG GGC CCC CCC TCG 
TAC TGG TAC TAA TGC GGT TCG AGC TTT AAT TGG GAG TGA TTT CCC TTG TTT TCG ACC CAT GGC CCG GGG GGG AGC 
MET Thr MET Ile Thr Pro Ser Ser Lys Leu Thr Leu Thr Lys Gly Asn Lys Ser Trp Val Pro Gly Pro Pro Ser 
  SalI        ClaI    HindIII EcoRV   EcoRI   PstI    SmaI      BamHI SpeI    XbaI      NotI
                727                 712                 697                 682                 667 
AGG TCG ACG GTA TCG ATA AGC TTG ATA TCG AAT TCC TGC AGC CCG GGG GAT CCA CTA GTT CTA GAG CGG CCG CCA 
TCC AGC TGC CAT AGC TAT TCG AAC TAT AGC TTA AGG ACG TCG GGC CCC CTA GGT GAT CAA GAT CTC GCC GGC GGT 
Arg Ser Thr Val Ser Ile Ser Leu Ile Ser Asn Ser Cys Ser Pro Gly Asp Pro Leu Val Leu Glu Arg Pro Pro

SacII     SacI
                652                 637                 622                 607 
CCG CGG TGG AGC TCC AAT TCG CCC TAT AGT GAG TCG TAT TAC AAT TCA CTG GCC GTC GTT TTA CAA C
GGC GCC ACC TCG AGG TTA AGC GGG ATA TCA CTC AGC ATA ATG TTA AGT GAC CGG CAG CAA AAT GTT G
Pro Arg Trp Ser Ser Asn Ser Pro Tyr Ser Glu Ser Tyr Tyr Asn Ser Leu Ala Val Val Leu Gln 
                                                         <--- t gac cgg cag caa aat g :m13 -20 primer

The MCS is designed so that if an insert is cloned into any of the restriction sites, the coding sequence of the  lacZ protein will be interrupted, resulting in a non-functional, probably truncated lacZ protein. The substrate X-gal is used to assay for lacZ activity in E. coli colonies.

X-GAL CLEAVAGE BY beta-GALACTOSIDASE

X-gal : 5-bromo-4-chloro-3indolyl-beta-D-galactoside.

V. LABELING DNA


IN CLASS EXERCISE: DNA polymerases

    A. Random-primed synthesis - probably most commonly-used method for making labeled DNA probes.

     
                                    ds-DNA                random 
                                                          oligonucleotides
                                                                 ATTG
                                 ACGGTCAATCTTCTTAAGCT    +  AGTG    TTGA
                                 TGCCAGTTAGAAGAATTCGT         TAAG   GCTT
                                           |  90C         GTCA
                                           |  reanneal
                                           |
                                           |
                                           v
        5'    GTCA                         ATTG          TAAG
        3' TGCCAGTTAGAAGAATTCGT TCGAATTCTTCTAACTGGCA TCGAATTCTTCTAACTGGCA
                                           | [biotin or fluorescent]dNTP
                                  early   | dNTP's, T4 DNA polymerase
                                           v
        5'    GTCAATCTTCTTA                ATTGACCGT     TAAGAAGATTGA
        3' TGCCAGTTAGAAGAATTCGT TCGAATTCTTCTAACTGGCA TCGAATTCTTCTAACTGGCA
                                           | 
                                  later    v 
                  *************                *****         ************
        5'    GTCAATCTTCTTAAGCA            ATTGACCGT     TAAGAAGATTGACCGT
        3' TGCCAGTTAGAAGAATTCGT TCGAATTCTTCTAACTGGCA TCGAATTCTTCTAACTGGCA
        {* indicates labeled strand}

Unless otherwise cited or referenced, all content on this page is licensed under the Creative Commons License Attribution Share-Alike 2.5 Canada
previous page PLNT3140 Introductory Cytogenetics
Lecture 7, part 3 of 3
first page