# Copyright 2006-2008 by Peter Cock. All rights reserved. # This code is part of the Biopython distribution and governed by its # license. Please see the LICENSE file that should have been included # as part of this package. """ Note ==== In TREE_PUZZLE (Schmidt et al. 2003) and PHYML (Guindon and Gascuel 2003) a dot/period (".") in a sequence is interpreted as meaning the same character as in the first sequence. The PHYLIP 3.6 documentation says: "a period was also previously allowed but it is no longer allowed, because it sometimes is used in different senses in other programs" At the time of writing, we do nothing special with a dot/period. """ from Bio.Alphabet import single_letter_alphabet from sets import Set from Bio.Align.Generic import Alignment from Interfaces import AlignmentIterator, SequentialAlignmentWriter class PhylipWriter(SequentialAlignmentWriter) : """Phylip alignment writer.""" def write_alignment(self, alignment) : """Use this to write (another) single alignment to an open file. This code will write interlaced alignments (when the sequences are longer than 50 characters). Note that record identifiers are strictly truncated at 10 characters. For more information on the file format, please see: http://evolution.genetics.washington.edu/phylip/doc/sequence.html http://evolution.genetics.washington.edu/phylip/doc/main.html#inputfiles """ truncate=10 records = alignment.get_all_seqs() handle = self.handle if len(records)==0 : raise ValueError("Must have at least one sequence") length_of_seqs = alignment.get_alignment_length() for record in records : if length_of_seqs <> len(record.seq) : raise ValueError("Sequences must all be the same length") if length_of_seqs <= 0 : raise ValueError("Non-empty sequences are required") if len(records) > len(Set([r.id[:truncate] for r in records])) : raise ValueError("Repeated identifier, possibly due to truncation") # From experimentation, the use of tabs is not understood by the # EMBOSS suite. The nature of the expected white space is not # defined in the PHYLIP documentation, simply "These are in free # format, separated by blanks". We'll use spaces to keep EMBOSS # happy. handle.write(" %i %s\n" % (len(records), length_of_seqs)) block=0 while True : for record in records : if block==0 : #Write name (truncated/padded to 10 characters) """ Quoting the PHYLIP version 3.6 documentation: The name should be ten characters in length, filled out to the full ten characters by blanks if shorter. Any printable ASCII/ISO character is allowed in the name, except for parentheses ("(" and ")"), square brackets ("[" and "]"), colon (":"), semicolon (";") and comma (","). If you forget to extend the names to ten characters in length by blanks, the program [i.e. PHYLIP] will get out of synchronization with the contents of the data file, and an error message will result. Note that Tab characters count as only one character in the species names. Their inclusion can cause trouble. """ name = record.id.strip() #Either remove the banned characters, or map them to something #else like an underscore "_" or pipe "|" character... for char in "[]()," : name = name.replace(char,"") for char in ":;" : name = name.replace(char,"|") #Now truncate and right pad to expected length. handle.write(name[:truncate].ljust(truncate)) else : #write 10 space indent handle.write(" "*truncate) #Write five chunks of ten letters per line... for chunk in range(0,5) : i = block*50 + chunk*10 seq_segment = record.seq.tostring()[i:i+10] #TODO - Force any gaps to be '-' character? Look at the alphabet... #TODO - How to cope with '?' or '.' in the sequence? handle.write(" %s" % seq_segment) if i+10 > length_of_seqs : break handle.write("\n") block=block+1 if block*50 > length_of_seqs : break handle.write("\n") class PhylipIterator(AlignmentIterator) : """Reads a Phylip alignment file returning an Alignment object iterator. Record identifiers are limited to at most 10 characters. It only copes with interlaced phylip files! Sequential files won't work where the sequences are split over multiple lines. For more information on the file format, please see: http://evolution.genetics.washington.edu/phylip/doc/sequence.html http://evolution.genetics.washington.edu/phylip/doc/main.html#inputfiles """ def _is_header(self, line) : line = line.strip() parts = filter(None, line.split()) if len(parts)<>2 : return False # First line should have two integers try : number_of_seqs = int(parts[0]) length_of_seqs = int(parts[1]) return True except ValueError: return False # First line should have two integers def next(self) : handle = self.handle try : #Header we saved from when we were parsing #the previous alignment. line = self._header del self._header except AttributeError : line = handle.readline() if not line: return line = line.strip() parts = filter(None, line.split()) if len(parts)<>2 : raise ValueError("First line should have two integers") try : number_of_seqs = int(parts[0]) length_of_seqs = int(parts[1]) except ValueError: raise ValueError("First line should have two integers") assert self._is_header(line) if self.records_per_alignment is not None \ and self.records_per_alignment <> number_of_seqs : raise ValueError("Found %i records in this alignment, told to expect %i" \ % (number_of_seqs, self.records_per_alignment)) ids = [] seqs = [] #Expects STRICT truncation/padding to 10 characters #Does not require any white space between name and seq. for i in range(0,number_of_seqs) : line = handle.readline().rstrip() ids.append(line[:10].strip()) #first ten characters seqs.append([line[10:].strip().replace(" ","")]) #Look for further blocks line="" while True : #Skip any blank lines between blocks... while ""==line.strip(): line = handle.readline() if not line : break #end of file if not line : break #end of file if self._is_header(line) : #Looks like the start of a concatenated alignment self._header = line break #print "New block..." for i in range(0,number_of_seqs) : seqs[i].append(line.strip().replace(" ","")) line = handle.readline() if (not line) and i+1 < number_of_seqs : raise ValueError("End of file mid-block") if not line : break #end of file alignment = Alignment(self.alphabet) for i in range(0,number_of_seqs) : seq = "".join(seqs[i]) if len(seq)<>length_of_seqs : raise ValueError("Sequence %i length %i, expected length %i" \ % (i+1, len(seq), length_of_seqs)) alignment.add_sequence(ids[i], seq) record = alignment.get_all_seqs()[-1] assert ids[i] == record.id or ids[i] == record.description record.id = ids[i] record.name = ids[i] record.description = ids[i] return alignment if __name__=="__main__" : print "Running short mini-test" phylip_text=""" 8 286 V_Harveyi_ --MKNWIKVA VAAIA--LSA A--------- ---------T VQAATEVKVG B_subtilis MKMKKWTVLV VAALLAVLSA CG-------- ----NGNSSS KEDDNVLHVG B_subtilis MKKALLALFM VVSIAALAAC GAGNDNQSKD NAKDGDLWAS IKKKGVLTVG YA80_HAEIN MKKLLFTTAL LTGAIAFSTF ---------- -SHAGEIADR VEKTKTLLVG FLIY_ECOLI MKLAHLGRQA LMGVMAVALV AG---MSVKS FADEG-LLNK VKERGTLLVG E_coli_Gln --MKSVLKVS LAALTLAFAV S--------- ---------S HAADKKLVVA Deinococcu -MKKSLLSLK LSGLLVPSVL ALS------- -LSACSSPSS TLNQGTLKIA HISJ_E_COL MKKLVLSLSL VLAFSSATAA F--------- ---------- AAIPQNIRIG MSGRYFPFTF VKQ--DKLQG FEVDMWDEIG KRNDYKIEYV TANFSGLFGL ATGQSYPFAY KEN--GKLTG FDVEVMEAVA KKIDMKLDWK LLEFSGLMGE TEGTYEPFTY HDKDTDKLTG YDVEVITEVA KRLGLKVDFK ETQWGSMFAG TEGTYAPFTF HDK-SGKLTG FDVEVIRKVA EKLGLKVEFK ETQWDAMYAG LEGTYPPFSF QGD-DGKLTG FEVEFAQQLA KHLGVEASLK PTKWDGMLAS TDTAFVPFEF KQG--DKYVG FDVDLWAAIA KELKLDYELK PMDFSGIIPA MEGTYPPFTS KNE-QGELVG FDVDIAKAVA QKLNLKPEFV LTEWSGILAG TDPTYAPFES KNS-QGELVG FDIDLAKELC KRINTQCTFV ENPLDALIPS LETGRIDTIS NQITMTDARK AKYLFADPYV VDG-AQITVR KGNDSIQGVE LQTGKLDTIS NQVAVTDERK ETYNFTKPYA YAG-TQIVVK KDNTDIKSVD LNSKRFDVVA NQVG-KTDRE DKYDFSDKYT TSR-AVVVTK KDNNDIKSEA LNAKRFDVIA NQTNPSPERL KKYSFTTPYN YSG-GVIVTK SSDNSIKSFE LDSKRIDVVI NQVTISDERK KKYDFSTPYT ISGIQALVKK GNEGTIKTAD LQTKNVDLAL AGITITDERK KAIDFSDGYY KSG-LLVMVK ANNNDVKSVK LQANKYDVIV NQVGITPERQ NSIGFSQPYA YSRPEIIVAK NNTFNPQSLA LKAKKIDAIM SSLSITEKRQ QEIAFTDKLY AADSRLVVAK NSDIQP-TVE DLAGKTVAVN LGSNFEQLLR DYDKDGKINI KTYDT--GIE HDVALGRADA DLKGKTVAAV LGSNHAKNLE SKDPDKKINI KTYETQEGTL KDVAYGRVDA DVKGKTSAQS LTSNYNKLAT N----AGAKV EGVEGMAQAL QMIQQARVDM DLKGRKSAQS ATSNWGKDAK A----AGAQI LVVDGLAQSL ELIKQGRAEA DLKGKKVGVG LGTNYEEWLR QNV--QGVDV RTYDDDPTKY QDLRVGRIDA DLDGKVVAVK SGTGSVDYAK AN--IKTKDL RQFPNIDNAY MELGTNRADA DLKGKRVGST LGSNYEKQLI DTG---DIKI VTYPGAPEIL ADLVAGRIDA SLKGKRVGVL QGTTQETFGN EHWAPKGIEI VSYQGQDNIY SDLTAGRIDA FIMDRLSALE -LIKKT-GLP LQLAGEPFET I-----QNAW PFVDNEKGRK YVNSRTVLIA -QIKKT-GLP LKLAGDPIVY E-----QVAF PFAKDDAHDK TYNDKLAVLN -YLKTSGNKN VKIAFETGEP Q-----STYF TFRKGS--GE TINDKLAVLD -YFKQHPNSG LKIAYDRGDK T-----PTAF AFLQGE--DA ILVDRLAALD -LVKKT-NDT LAVTGEAFSR Q-----ESGV ALRKGN--ED VLHDTPNILY -FIKTAGNGQ FKAVGDSLEA Q-----QYGI AFPKGS--DE AYNDRLVVNY -IINDQ-KLP VRGAGQIGDA A-----PVGI ALKKGN--SA AFQDEVAASE GFLKQPVGKD YKFGGPSVKD EKLFGVGTGM GLRKED--NE LQAEVNKALA EMRADGTVEK ISVKWFGADI TK---- LRKKVNKALD ELRKDGTLKK LSEKYFNEDI TVEQKH VVDQVNKALK EMKEDGTLSK ISKKWFGEDV SK---- LITKFNQVLE ALRQDGTLKQ ISIEWFGYDI TQ---- LLKAVNDAIA EMQKDGTLQA LSEKWFGADV TK---- LRDKVNGALK TLRENGTYNE IYKKWFGTEP K----- LKDQIDKALT EMRSDGTFEK ISQKWFGQDV GQP--- LREALNKAFA EMRADGTYEK LAKKYFDFDV YGG--- """ from cStringIO import StringIO handle = StringIO(phylip_text) count=0 for alignment in PhylipIterator(handle) : for record in alignment.get_all_seqs() : count=count+1 print record.id #print record.seq.tostring() assert count == 8 expected="""mkklvlslsl vlafssataa faaipqniri gtdptyapfe sknsqgelvg fdidlakelc krintqctfv enpldalips lkakkidaim sslsitekrq qeiaftdkly aadsrlvvak nsdiqptves lkgkrvgvlq gttqetfgne hwapkgieiv syqgqdniys dltagridaafqdevaaseg flkqpvgkdy kfggpsvkde klfgvgtgmg lrkednelre alnkafaemradgtyeklak kyfdfdvygg""".replace(" ","").replace("\n","").upper() assert record.seq.tostring().replace("-","") == expected #From here: #http://atgc.lirmm.fr/phyml/usersguide.html phylip_text2="""5 60 Tax1 CCATCTCACGGTCGGTACGATACACCTGCTTTTGGCAG Tax2 CCATCTCACGGTCAGTAAGATACACCTGCTTTTGGCGG Tax3 CCATCTCCCGCTCAGTAAGATACCCCTGCTGTTGGCGG Tax4 TCATCTCATGGTCAATAAGATACTCCTGCTTTTGGCGG Tax5 CCATCTCACGGTCGGTAAGATACACCTGCTTTTGGCGG GAAATGGTCAATATTACAAGGT GAAATGGTCAACATTAAAAGAT GAAATCGTCAATATTAAAAGGT GAAATGGTCAATCTTAAAAGGT GAAATGGTCAATATTAAAAGGT""" phylip_text3="""5 60 Tax1 CCATCTCACGGTCGGTACGATACACCTGCTTTTGGCAGGAAATGGTCAATATTACAAGGT Tax2 CCATCTCACGGTCAGTAAGATACACCTGCTTTTGGCGGGAAATGGTCAACATTAAAAGAT Tax3 CCATCTCCCGCTCAGTAAGATACCCCTGCTGTTGGCGGGAAATCGTCAATATTAAAAGGT Tax4 TCATCTCATGGTCAATAAGATACTCCTGCTTTTGGCGGGAAATGGTCAATCTTAAAAGGT Tax5 CCATCTCACGGTCGGTAAGATACACCTGCTTTTGGCGGGAAATGGTCAATATTAAAAGGT""" handle = StringIO(phylip_text2) list2 = list(PhylipIterator(handle)) handle.close() assert len(list2)==1 assert len(list2[0].get_all_seqs())==5 handle = StringIO(phylip_text3) list3 = list(PhylipIterator(handle)) handle.close() assert len(list3)==1 assert len(list3[0].get_all_seqs())==5 for i in range(0,5) : list2[0].get_all_seqs()[i].id == list3[0].get_all_seqs()[i].id list2[0].get_all_seqs()[i].seq.tostring() == list3[0].get_all_seqs()[i].seq.tostring() #From here: #http://evolution.genetics.washington.edu/phylip/doc/sequence.html #Note the lack of any white space between names 2 and 3 and their seqs. phylip_text4=""" 5 42 Turkey AAGCTNGGGC ATTTCAGGGT Salmo gairAAGCCTTGGC AGTGCAGGGT H. SapiensACCGGTTGGC CGTTCAGGGT Chimp AAACCCTTGC CGTTACGCTT Gorilla AAACCCTTGC CGGTACGCTT GAGCCCGGGC AATACAGGGT AT GAGCCGTGGC CGGGCACGGT AT ACAGGTTGGC CGTTCAGGGT AA AAACCGAGGC CGGGACACTC AT AAACCATTGC CGGTACGCTT AA""" #From here: #http://evolution.genetics.washington.edu/phylip/doc/sequence.html phylip_text5=""" 5 42 Turkey AAGCTNGGGC ATTTCAGGGT GAGCCCGGGC AATACAGGGT AT Salmo gairAAGCCTTGGC AGTGCAGGGT GAGCCGTGGC CGGGCACGGT AT H. SapiensACCGGTTGGC CGTTCAGGGT ACAGGTTGGC CGTTCAGGGT AA Chimp AAACCCTTGC CGTTACGCTT AAACCGAGGC CGGGACACTC AT Gorilla AAACCCTTGC CGGTACGCTT AAACCATTGC CGGTACGCTT AA""" phylip_text5a=""" 5 42 Turkey AAGCTNGGGC ATTTCAGGGT GAGCCCGGGC AATACAGGGT AT Salmo gairAAGCCTTGGC AGTGCAGGGT GAGCCGTGGC CGGGCACGGT AT H. SapiensACCGGTTGGC CGTTCAGGGT ACAGGTTGGC CGTTCAGGGT AA Chimp AAACCCTTGC CGTTACGCTT AAACCGAGGC CGGGACACTC AT Gorilla AAACCCTTGC CGGTACGCTT AAACCATTGC CGGTACGCTT AA""" handle = StringIO(phylip_text4) list4 = list(PhylipIterator(handle)) handle.close() assert len(list4)==1 assert len(list4[0].get_all_seqs())==5 handle = StringIO(phylip_text5) try : list5 = list(PhylipIterator(handle)) assert len(list5)==1 assert len(list5[0].get_all_seqs())==5 print "That should have failed..." except ValueError : print "Evil multiline non-interlaced example failed as expected" handle.close() handle = StringIO(phylip_text5a) list5 = list(PhylipIterator(handle)) handle.close() assert len(list5)==1 assert len(list4[0].get_all_seqs())==5 print "Concatenation" handle = StringIO(phylip_text4 + "\n" + phylip_text4) assert len(list(PhylipIterator(handle))) == 2 handle = StringIO(phylip_text3 + "\n" + phylip_text4 + "\n\n\n" + phylip_text) assert len(list(PhylipIterator(handle))) == 3 print "OK" print "Checking write/read" handle = StringIO() PhylipWriter(handle).write_file(list5) handle.seek(0) list6 = list(PhylipIterator(handle)) assert len(list5) == len(list6) for a1,a2 in zip(list5, list6) : assert len(a1.get_all_seqs()) == len(a2.get_all_seqs()) for r1, r2 in zip(a1.get_all_seqs(), a2.get_all_seqs()) : assert r1.id == r2.id assert r1.seq.tostring() == r2.seq.tostring() print "Done"