release 2.4.0 2017-11-03 =============================================== This release adds a new feature to primer3_core and related C code. PCR PRIMER DESIGN TEMPLATE MASKING BEFORE PRIMER DESIGN. This feature helps to prevent designing primers to template regions that are repetitive. Primers with more binding sites tend to have higher failure rates. The masking is based on statistical model (see Documentation for details). NEW INPUT TAGS AND DEFAULT VALUES: PRIMER_MASK_TEMPLATE=0 PRIMER_FAILURE_RATE=0.1 PRIMER_MASK_5P_DIRECTION=1 PRIMER_MASK_3P_DIRECTION=1 PRIMER_MASKING_LIST_PREFIX=homo_sapiens PRIMER_WT_FAILURE_RATE=0.0 PRIMER_KMER_LISTS_PATH=../kmer_lists/ See the documentation for details. The tag PRIMER_MASK_TEMPLATE directs primer3_core to premask template sequence for primer design. NEW EXECUTABLE: primer3_masker masker masks repetitive regions in INPUTFILE (given as fasta and/or multiple fasta format) based on statistical approach. IMPORTANT: because PRIMER_MASK_TEMPLATE=1, PRIMER_KMER_LISTS_PATH must point to the right location. This tag specifies the path to the directory that contains kmer list files used by the template masking approach. The default location: ../kmer_lists/ If the list files are not in that location, be sure to set PRIMER_KMER_LISTS_PATH By default, directory ../kmer_lists/ contains example kmers. Software for making kmers can be downloaded http://bioinfo.ut.ee/FastGT/index.php?r=site/index Premade list files can be downloaded from: http://primer3.ut.ee/lists.htm In 2016: Major correction: 1. The long primer3_core comand line options with single hyphen (-myargs) are depreciated. Use double hyphens (--myargs) instead. 2. The PRIMER_TASK pick_discriminative_primers was modified. Now the primer border the provided SEQUENCE_TARGET and do not overlap by one basepair. Minor fixes: 1. The test scripts were updated to use the default valgrind path and to use the --type comand line arguments instead of -type. 2. In thal.c the function finite() was replaced by the c99 isfinite(). 3. In libprimer3 all abort() functions were removed and error handling implemented. release 2.3.7 2016-02-18 =============================================== Major correction: In some cases, ntthal resulted with two different dimer structures depending on the order of the two oligo sequences were given by the user. For example: ntthal -s1 ACTGGAAAGAGGAAGGACTGGT -s2 TGGGACATCTCTATACCTTCCTCT Calculated thermodynamical parameters for dimer: dS = -207.817 dH = -73000 dG = -8545.56 t = 26.0559 SEQ ACTGGAAA ACTGGT--------- SEQ GAGGAAGG STR CTCCTTCC STR T ATATCTCTACAGGGT If the order of two oligo sequences change places, ntthal resulted with other structure and other values of thermodynamic parameters. ntthal -s2 ACTGGAAAGAGGAAGGACTGGT -s1 TGGGACATCTCTATACCTTCCTCT Calculated thermodynamical parameters for dimer: dS = -290.416 dH = -93600 dG = -3527.63 t = 13.4587 SEQ TGGGA TCTCTATA T------- SEQ CA CCTTCCTC STR GT GGAAGGAG STR TG CA------ AAAGGTCA What was modified in the code: 1. calculation of melting temperature values were replaced with calculation of dG values as calculating Tm values cannot result always the most stabile dimer as dimers melting temperature depends significantly on salt correction 2. Dimers 5` end stability was calculated only when the most stabile dimer was found. Now 5` ends stability is also considered at each dynamic programming stage. 3. Some values of thermodynamic table were changed as they were not symmetrical 4. Although AT dangling ends are more stable than AT pairing, ntthal now prefers AT pairing to AT dangling end. Now primer3 results: ntthal -s1 ACTGGAAAGAGGAAGGACTGGT -s2 TGGGACATCTCTATACCTTCCTCT Calculated thermodynamical parameters for dimer: dS = -198.019 dH = -69700 dG = -8284.27 t = 24.4823 SEQ ACTGGAA ACTGGT--------- SEQ AGAGGAAGG STR TCTCCTTCC STR ATATCTCTACAGGGT ntthal -s2 ACTGGAAAGAGGAAGGACTGGT -s1 TGGGACATCTCTATACCTTCCTCT Calculated thermodynamical parameters for dimer: dS = -198.019 dH = -69700 dG = -8284.27 t = 24.4823 SEQ TGGGACATCTCTATA ------- SEQ CCTTCCTCT STR GGAAGGAGA STR TGGTCA AAGGTCA We have also added tests for this bug. Minor fixes: 1. updated oligotm executable to accept float values as input for the concentration of monovalent cations and for concentration of DNA strands. release 2.3.6 2013-10-22 =============================================== Important changes: 1. Four new input tags were added: - PRIMER_MUST_MATCH_THREE_PRIME - PRIMER_MUST_MATCH_FIVE_PRIME - PRIMER_INTERNAL_MUST_MATCH_THREE_PRIME - PRIMER_INTERNAL_MUST_MATCH_FIVE_PRIME The MUST_MATCH tags allow to define 5 nt patterns which the first and the last five bases of a primer or oligo have to match. For example, the pattern "NNGTN" would require the 3rd and 2nd last bases to be G and T respectively. Minor fixes: 1. Fixed two bugs in ntdpal and oligotm that caused segmentation fault whenever these binaries were called without specifying a given option value. release 2.3.5 2013-01-03 =============================================== Important changes: 1. The tag PRIMER_THERMODYNAMIC_ALIGNMENT was replaced by two new tags: - PRIMER_THERMODYNAMIC_OLIGO_ALIGNMENT which governs hairpin and oligo-oligo interactions. Therefore, whenever it is set to 1 (the default) thermodynamic alignments will be used for oligo- oligo interactions and hairpins. - PRIMER_THERMODYNAMIC_TEMPLATE_ALIGNMENT which governs the oligo-template interactions and, when set to 1 (default is 0), will cause primer3 to use the thermodynamic alignment against templates. The reason for this change is to provide the option of using the old alignment for oligo-template interactions when the thermodynamic alignment is too slow or the template is too long (there is a hard limit THAL_MAX_SEQ=10k on the length of sequences involved in thermodynamic alignments). 1.1 Added corresponding functions to libprimer3.c and libprimer3.h: p3_set_gs_primer_thermodynamic_oligo_alignment p3_set_gs_primer_thermodynamic_template_alignment 2. Modified the error handling of non-memory related errors that can occur during the thermodynamic alignment. They are no longer fatal errors. 3. Made a performance improvement for the case when thermodynamic alignment is used for templates: the alignment is done only once for each oligo and the result is kept. This way we avoid performing the same expensive alignment more than once. 4. Removed io_version 3, which was only kept for backward compatibility with very old versions of primer3. 5. Fixed an error in which PRIMER_DNTP_CONC > PRIMER_SALT_DIVALENT causes Primer3 to crash. 6. Fixed a bug that made Primer3 not generate results in some cases when PRIMER_FIRST_BASE_INDEX is negative. Minor corrections: 1. Added function p3_set_max_end_gc (sets max_end_gc in the primer_global_settings struct). 2. Removed intentional compile time division by zero in thal.c if macro INFINITY is defined. 3. Updated text in error messages from function thal() to make them more informative. release 2.3.4 2012-05-30 =============================================== Major correction: 1. Fixed error in which PRIMER_..._..._TEMPLATE_MISPRIMING_TH was calculated incorrectly in libprimer3.c release 2.3.3 2012-05-18 =============================================== Major correction: 1. Fixed error in which non-default values of monovalent and divalent salt concentrations and non-default values of dNTP and DNA concentrations were being ignored in thermodynamic calculations. release 2.3.2 2012-03-15 =============================================== Minor corrections: 1. _Removed_ warning if PRIMER_INTERNAL_SALT_DIVALENT > 0.0 but PRIMER_INTERNAL_DNTP_CONC <= 0.0. (dNTPs not used in hybridizations.) release 2.3.1 2012-02-27 =============================================== Minor corrections: 1. Added warnings if PRIMER_SALT_DIVALENT > 0.0 but PRIMER_DNTP_CONC <= 0.0 or PRIMER_INTERNAL_SALT_DIVALENT > 0.0 but PRIMER_INTERNAL_DNTP_CONC <= 0.0. 2. No longer an error if a settings file has PRIMER_THERMODYNAMIC_ALIGNMENT=1 but does not have a valid PRIMER_THERMODYNAMIC_PARAMETERS_PATH. (PRIMER_THERMODYNAMIC_PARAMETERS_PATH can then be set in the regular boulder IO input stream.) 3. Updates to documetation on salt corrections. 4. Corrections to primer3web_v3_0_0_default_settings.txt (removed non-existent tags and removed the setting of PRIMER_THERMODYNAMIC_PARAMETERS_PATH) 5. Removed un-needed files from distribution .tar.gz file. 6. Removed the -i option from the oligotm executable, as the necessary information is in the Primer3 manual. 7. Updated PRIMER_PRODUCT_SIZE_RANGE in primer3web_v3_0_0_default_settings to same value as in previous version of primer3web. release 2.3.0 2012-02-03 =============================================== 1. *** We changed the following default values: 1.1 Changing default oligo temperature calculations PRIMER_TM_FORMULA=1 (was 0) PRIMER_SALT_CORRECTIONS=1 (was 0) 1.2 Making thermodynamic secondary structure calculations the default: PRIMER_THERMODYNAMIC_ALIGNMENT=1 (was 0) 1.3 The following need reasonable values to support the changes in 1.1 and 1.2 above: PRIMER_SALT_DIVALENT=1.5 (was 0.0) PRIMER_DNTP_CONC=0.6 (was 0.0) 1.4 To make old defaults easily accessible, we added a command line argument, --default_version=1, which directs primer3_core to use the old defaults. --default_version=2 directs primer3_core to use the new defaults. The default is --default_version=2. 1.5 IMPORTANT: because PRIMER_THERMODYNAMIC_ALIGNMENT=1, PRIMER_THERMODYNAMIC_PARAMETERS_PATH must point to the right location. This tag specifies the path to the directory that contains all the parameter files used by the thermodynamic approach. In Linux, there are two *default* locations that are tested if this tag is not defined: ./primer3_config/ and /opt/primer3_config/. For Windows, there is only one default location: .\primer3_config\. If the the parameter files are not in one these locations, be sure to set PRIMER_THERMODYNAMIC_PARAMETERS_PATH 1.6 Changed default for PRIMER_LIB_AMBIGUITY_CODES_CONSENSUS=0 (was 1) (0 is almost always the the behavior one wants.) 1.7 To get the behavior of -default_version=1 when -default_version=2 set the following: PRIMER_TM_FORMULA=0 PRIMER_SALT_CORRECTIONS=0 PRIMER_THERMODYNAMIC_ALIGNMENT=0 PRIMER_SALT_DIVALENT=0.0 PRIMER_DNTP_CONC=0.0 PRIMER_LIB_AMBIGUITY_CODES_CONSENSUS=1 1.8 To get the behavior of -default_version=2 when -default_version=1 set the following: PRIMER_TM_FORMULA=1 PRIMER_SALT_CORRECTIONS=1 PRIMER_THERMODYNAMIC_ALIGNMENT=1 PRIMER_SALT_DIVALENT=1.5 PRIMER_DNTP_CONC=0.6 PRIMER_LIB_AMBIGUITY_CODES_CONSENSUS=0 2. We changed the NULL value for SEQUENCE_FORCE_{LEFT,RIGHT}_START_END to -1000000, and made it an error to select PRIMER_FIRST_BASE_INDEX <= this value. This is to correct an error when SEQUENCE_FORCE_{LEFT,RIGHT}_START_END was -1 (value previously used to indicate a NULL) but PRIMER_FIRST_BASE_INDEX was < 0, which caused the intended NULL value (-1) to be treated as a constraint on primer location (a constraint that was not possible to satisfy). 3. We changed the PRIMER_TASK called 'pick_detection_primers' to 'generic' while retaining 'pick_detection_primers' as an alias for backward compatibility. 4. The code now uses 'end' alignments when assessing template mispriming using thermodynamic alignments. This is consistent with the approach taken with the previous alignment algorithm and with checking for mispriming against repeat libraries. 4. We removed PRIMER_PAIR_MAX_HAIRPIN_TH (which was ignored previously). 5. Primer3 now requires the user to set SEQUENCE_TARGET, not SEQUENCE_INCLUDED_REGION when PRIMER_TASK=pick_discriminative_primers 5. When PRIMER_TASK=pick_discriminative_primers or PRIMER_TASK=pick_cloning_primers the value of SEQUENCE_INCLUDED_REGION is no longer changed to the entire input sequence. 6. The handling of divalent cations when PRIMER_SALT_CORRECTIONS=2 (not the default and not the recommended value) has been updated. The rationale is that, when divalent cations are present, the formula by Owczarzy et al., 2004 (used previously by Primer3) can be improved upon as described in (Ahsen et al., 2010; Owczarzy et al., 2008). Therefore we have updated the melting temperature calculation to follow the scheme in Figure 9 of (Owczarzy et al., 2008). Please find references to these papers in the Primer3 manual. 7. In addition, several error corrections: 7.1 Corrected a short, fixed-size buffer for the file/path names specified by the command line arguments -output, -error and for the settings file. 7.2 Two other corrected errors were in p3_set_gs_primer_self_end and p3_set_gs_primer_internal_oligo_self_end, which erroneously multiplied their 'val' arguments by 100. 7.3 Primer3 now detects and handles the situation in which user-supplied primers (SEQUENCE_PRIMER and SEQUENCE_PRIMER_REVCOMP) have the left primer to the right of the right primer. Also issue a warning if user-supplied primers occur in more than one location in the template. release 2.2.3 2010-07-08 =============================================== Minor error corrections, minor cleanup. This is a stable release. release 2.2.2 beta 2010-03-04 ========================================== This release adds a performance enhancement for inputs involving SEQUENCE_PRIMER_PAIR_OK_REGION_LIST. This release adds two new tags, PRIMER_MIN_LEFT_THREE_PRIME_DISTANCE and PRIMER_MIN_RIGHT_THREE_PRIME_DISTANCE release 2.2.1 alpha 2009-10-28 ========================================== This release adds several performance enhancements. release 2.2.0 alpha 2009-10-23 ========================================== This release adds multiple new features to primer3_core and related C code. The enhancements fall under several categories: 1. PRIMER/OLIGO SECONDARY STRUCTURE AND PRIMER-DIMER AND TEMPLATE MISPRIMING PREDICTION We added capabilities for predicting secondary structure, primer-dimer, and template mispriming based on a thermodynamic model. INPUT/OUTPUT TAGS: Added tags PRIMER_THERMODYNAMIC_ALIGNMENT, PRIMER_INTERNAL_MAX_{HAIRPIN,SELF_ANY_TH,SELF_END_TH,TEMPLATE_MISHYB_TH}, PRIMER_INTERNAL_WT_{HAIRPIN,SELF_ANY_TH,SELF_END_TH,TEMPLATE_MISHYB_TH}, PRIMER_MAX_{HAIRPIN,SELF_ANY_TH,SELF_END_TH,TEMPLATE_MISPRIMING_TH}, PRIMER_PAIR_MAX_{COMPL_ANY_TH,COMPL_END_TH,HAIRPIN,TEMPLATE_MISPRIMING_TH}, PRIMER_PAIR_WT_{COMPL_ANY_TH,COMPL_END_TH,HAIRPIN,TEMPLATE_MISPRIMING_TH}, PRIMER_WT_{HAIRPIN,SELF_ANY_TH,SELF_END_TH,TEMPLATE_MISPRIMING_TH} See the documentation for details. The tag PRIMER_THERMODYNAMICAL_ALIGNMENT=1 directs primer3_core to use the thermodynamic alignments. NEW EXECUTABLE: ntthal ntthal is analogous to ntdpal. Between two sequences, ntthal finds alignment/sec structure, that has the highest melting temperature. Ntthal is based on nearest-neighbor thermodynamical approach. For input parameters to ntthal, execute: ./ntthal (without arguments). 2. NEW COMMAND LINE FLAGS AND ARGUMENTS primer3_core now has a more conventional command line. For example, you can type primer3_core -output my_output -error my_error my_input and primer3_core will take its input from my_input and put its outputs in the files my_output and my_error. There is also a command line flag -echo_settings_file to cause the settings file contents to be echoed to output. 3. NEW INPUT TAGS TO CONTROL PRIMER LOCATION See the documentation for SEQUENCE_PRIMER_PAIR_OK_REGION_LIST. Tags SEQUENCE_OVERLAP_JUNCTION_LIST, PRIMER_MIN_3_PRIME_OVERLAP_OF_JUNCTION, PRIMER_MIN_5_PRIME_OVERLAP_OF_JUNCTION have _replaced_ SEQUENCE_PRIMER_OVERLAP_POS and PRIMER_POS_OVERLAP_TO_END_DIST. See the documentation. 4. PERFORMANCE IMPROVEMENTS release 2.0.0 alpha 2008-12-15 ========================================== This is major release, involving enhancements to functionality, software architecture, and input and output conventions. INPUT/OUTPUT CHANGES: * A new command line flag, -io_version=3 provides backward compatible behavior for boulder IO input, and boulder IO output that is backward compatible except for error messages, warnings, and the text of PRIMER...EXPLAIN tags. * -io_version=3 IS NOT the default -- you must specify it on the command line. For the new default IO, we renamed many Boulder IO INPUT/OUTPUT TAGS for clarification and easier integration into scripts NEW OR IMPROVED FUNCTIONALITY: Primer3 'settings' files were added. A settings file can be read in at program start up to set global parameters. Our intent is that parameter values suitable for particular primer design objectives can be easily stored and re-used. We added new "tasks" such as selection of primer lists, sequencing primers, or cloning primers, or the checking of primers or primer pairs in the absence of a target sequence. See tag PRIMER_TASK. It is now possible to request only unique primers when multiple primer pairs are requested. (In the past, each _pair_ was unique, but the same primer might occur in more than one pair). The user also has some control over what constitutes a 'unique' primer. See tag PRIMER_MIN_THREE_PRIME_DISTANCE. When an illegal primer pair is specified for checking primer3, the program now assess it. In the past, primer3 assessed individual primers if they violated a constraint, but in some cases not pairs that violated constraints on pairs (such as product size). We added new functionality with tags SEQUENCE_PRIMER_OVERLAP_POS, PRIMER_POS_OVERLAP_TO_END_DIST, PRIMER_MAX_END_GC. Please see the documentation. We added tags PRIMER_PAIR_MAX_COMPL_END and PRIMER_PAIR_MAX_COMPL_ANY, which previously took the same values as PRIMER_SELF_{END,ANY} OTHER CHANGES TO BEHAVIOR: We corrected a few errors and a mis-feature in the ways in which primer3 searches for primer pairs. Consequently, the latest version of primer3 will return different sets of primer pairs in a few instances. INTERNAL CHANGES: It is now possible to use the main primer3 functionality from a single C function. We cleanly separated the functionality of reading in Boulder IO records from the primer choosing / designing functionality. We also substantially simplified the organization and documentation of the main primer picking code, now in libprimer3.[ch]. The file libprimer3.h specifies the external interface, although it is not separately documented. It is also possible to create a binary library file that provides this functionality (libprimer3.a or libprimer3.so in Unix/Linux). All C code is ANSI C. release 1.1.2 2007-06-10 ================================================ Updates to dpal.c so that no error forces an exit. Adaptation in primer3_main.c and ntdpal_main.c to updated error handling in dpal(). Arranged for primer3_main.c align() to check for and circumvent local alignments to "targets" < nucleotides long, and added tests for this condition. Comment and code readability updates in dpal.h and dpal.c release 1.1.1 3/37/2007 ================================================== Minor corrections release 1.1.0 1/17/2007 ================================================== Added tags PRIMER_TM_SANTALUCIA, PRIMER_SALT_CORRECTIONS, PRIMER_LOWERCASE_MASKING, PRIMER_DIVALENT_CONC, and PRIMER_DNTP_CONC. See the README for details of what these tags do. Briefly, the first two tags allow the use of modern melting temperature calculations. New tests for this functionality were added to the tests/ subdirectory NOTE: The oligotm executable now takes additional arguments. Cleaned up Makefile, and created Makefile for the test directory with a target to clean up after tests Most (but not all) temporary files created by the tests now end in .tmp or .tmp2 Tried to create more informative test for MAX_PRIMER_LENGTH > DPAL_MAX_ALIGN in primer3_main.c NOTE: The oligtotm() function is now provided as a library, liboligotm. NOTE: non-backward compatible change: removed support of flag -2x_compat. release 1.0.1 11/06 ================================================== Identical to 1.0b except for release number release 1.0b 11/06 ================================================== Corrected bug involving check for template mispriming Minor code cleanup release 1.0a 9/06 ================================================== No new functionality (bug fixes and minor code cleanup only) Bug fixes: * Corrected calculation of ..._TEMPLATE_MISPRIMING when INCLUDED_REGION was set (thanks to Tomoaki Nishiyama, Advanced Sciences Research Center, Kanazawa University, Japan). * Corrected error that caused crash when PRIMER_WT_TEMPLATE_MISPRIMING was set (thanks to Peng Yu, Functional Genomics Group II, Chinese National Human Genome Center, Beijing). * Added olgiotm_main.c (for executable oligotm) release 1.0 6/04 ================================================== Added ability to search source sequence (template) for mispriming or mishybing sites. Added _experimental_ facility to calculate Tm on long oligos using a GC% based formula. Miscellaneous fixes and cleanup, including: * Avoiding closing NULL file handles when a mispriming or mishyb library is missing * Correction to long_seq_tm() in oligotm.c plus addition of related tests. * Gave user the ability to _not_ treat IUB/IUPAC ambiguity codes as a consensus while matching against mispriming or mishyb libraries. Inability to turn off this "feature" caused severe problems when libraries contained strings of N's: NNNNNNNNN, since if N is treated as a consensus, any base matches. release 0.9 9/98 ================================================== Corrected errors in calculation of amplicon Tm. release 0.8 6/98 ================================================== Added flexible objective function. Various tags governing the penalty weights are not fully documented in this release. Added much changed web interface. Added ability to select only a single left or right primer or hyb probe. Made it possible to continue even if PRIMER_{LEFT,RIGHT,INTERNAL_OLIGO}_INPUT is not legal. Added PRIMER_{LEFT,RIGHT,INTERNAL_OLIGO}_GC_PERCENT output tags. release 0.7 5/98 ================================================== Fixed the 'case problem' for PRIMER_{LEFT,RIGHT,INTERNAL_OLIGO}_INPUT (and at the same time a related bug). Added experimental PRIMER_START_CODON_POSITION tag and related outputs. This feature should still be considered experimental and the user should scrutinize the output. Added PRIMER_PRODUCT_{MAX,MIN}_TM and related outputs. release 0.6 ================================================== Bug fixes (most introduced as part of 0.5 enhancements). release 0.5 ================================================== ** Non-Backward compatible change: Fixed inconsistency in output format; PRIMER_INTERNAL_n_OLIGO_SEQUENCE -> PRIMER_INTERNAL_OLIGO_n_SEQUENCE. The old format can be preserved by compiling with the precompiler symbol USE_OLD_FORMAT_MISTAKE defined. Added end-anchored local alignment option to dpal. Removed some un-needed dpal implementations. Added end-anchored local alignments for checking mispriming libraries. Added mispriming estimates for primer _pairs_ (see PRIMER_PAIR_MISPRIMING_LIBRARY), with related new output tags. Trivial change in maximum allowable library sequence weight. Added an experimental primer position component to the objective function (PRIMER_{IN,OUT}SIDE_PENALTY), with related new output tags. Added sequence quality scores as constraints in primer picking (PRIMER_MIN_{,END_}_QUALITY, PRIMER_QUALITY_RANGE_{MIN,MAX}) with related new output tags. Added more error reporting to primer3.cgi when primer3 exits with a non-0 termination status. Fixed bug when non-0, non-1 value was supplied for pick internal oligos. Added PRIMER_{LEFT,RIGHT,INTERNAL_OLIGO}_INPUT for checking or for designing around existing primers or internal oligos. Added error checking for duplicates of certain tags, such as SEQUENCE. Added PRIMER_MAX_END_STABILITY and related changes to output. release 0.4b ================================================== Corrected bug in parsing of INCLUDED_REGION tag. release 0.4 ================================================== Added optional check of oligos against "mispriming" or "mishyb" libraries with related changes to formated output and to the contents of primer list files. Modified search algorithm to compute complementarity/ similarity measures as late as possible. Got rid of quotes (") around error and warning strings. Fixed numerical overflow on input sequences longer than MAX_SHRT. (Thanks to Pete Young for finding this one.) release 0.3 ================================================== Changes to dpal to make it substantially faster on the maxgap=1 case for local and end-anchored complementarity measures. Removed restriction on maximum sequence length (by removing ftar, fexcl, fexcl_int, fnn, fn, fgc arrays, which necessitated internal changes to methods for calculating overlap with excluded regions and targets and to calculate spanning of targets. Modified 'primer list' format (clean up and hopefully got rid of spurious regression test discrepancy on some systems due to differences in rounding). Exit codes for some errors changed. Text of error messages for PRIMER_PRODUCT_SIZE -> PRIMER_PRODUCT_SIZE_RANGE. Some errors that should have been global (fatal) were not. These were fixed and error handling rationalized somewhat. An error in the display of the start position of targets, and excluded regions in formated output was corrected. An error in which overlapping product size ranges caused primer3 to return duplicate primer pairs was corrected. Made regression tests more complete. Made the maximum number of primer pairs to return a parameter (PRIMER_NUM_RETURN). Added optional n-based indexing in input and output (PRIMER_FIRST_BASE_INDEX=n). Has not been tested for n < 0. release 0.2b (10/11/96) ================================================== Added PRIMER_WARNING tag. Made it legal for excluded regions and targets to lie outside of included region. Documentation fixes (especially to PRIMER_DNA_CONC). release 0.2a ================================================== Tweaks to formated output to make it more complete (included complementarity measures); adjusted tests. release 0.2 ================================================== Made 0-length excluded region legal, and adjusted tests. Tweaked error reporting of negative-length excluded regions, internal oligo excluded regions, and target. ============================================================== ============================================================== Compared to non-primer3 progenitors: Compared to primer 0.5 --------------- Completely different input format. It has been reported the 0.5 deleted Ns when they occurred in primers. More stringent self-complementarity defaults. Primer3 selects internal oligos on request (and produces .int files if requested). Compared to both primer 0.5 and primer v2 --------------------------- The format of the contents of .for, .rev (and .int) files is different. Primer3 returns a user-specifiable number of primer pairs (or triples) sorted by "goodness". Primer3 will find a primer pair if any acceptable pair exists. Optional n-based indexing into source sequence. Use of sequence quality and 3' stability as constraints in primer picking. Optional positional component to objective function. Compared to primer v2 ------------- Tag name changes. However, primer3 should understand most or all Primer v2 input tags, and should produce v2-compatible output tag names when the -v2_compat command-line switch is used. The one exception is that the PRIMER_RECOMMEND tag is no longer produced. Instead primer3 produces the PRIMER_x_EXPLAIN output tags. The format of the data in this tags is different from the data in v2's PRIMER_RECOMMEND output tag. Numerous fixes. Uses the PRIMER_SELF_ANY and PRIMER_SELF_END parameters to govern maximum allowable complementarity between left and right primers, as well as complementarity between copies of a single oligo or within a single oligo. This behaviour is very close to that of primer 0.5; self complementarity calculations in v2 were unreliable. Primer3 produces much more output information, including the TMs and self complementarity measures of selected primers.