#include "UtilityFunctions.hpp" // from http://stackoverflow.com/questions/2380962/generate-all-combinations-of-arbitrary-alphabet-up-to-arbitrary-length std::vector getAllWords(int length) { int N_LETTERS = 4; char alphabet[] = {'A', 'C', 'G', 'T'}; std::vector index(length, 0); std::vector words; while(true) { std::string word(length, ' '); for (int i = 0; i < length; ++i) word[i] = alphabet[index[i]]; words.push_back(word); for (int i = length-1; ; --i) { if (i < 0) return words; index[i]++; if (index[i] == N_LETTERS) index[i] = 0; else break; } } } #include SCENARIO("Kmers encode and decode correctly") { using salmon::utils::Direction; GIVEN("All 6-mers") { std::vector kmers = getAllWords(6); //KmerDist<6, std::atomic> kh; for (auto& k : kmers) { auto i = indexForKmer(k.c_str(), 6, Direction::FORWARD); auto kp = kmerForIndex(i, 6); WHEN("kmer is [" + k + "]") { THEN("decodes as [" + kp + "]") { REQUIRE(k == kp); } } } } } std::string rc(const std::string& s) { std::string rc; for (int32_t i = s.size() - 1; i >= 0; --i) { switch(s[i]) { case 'A': rc += 'T'; break; case 'C': rc += 'G'; break; case 'G': rc += 'C'; break; case 'T': rc += 'A'; break; } } return rc; }; SCENARIO("Kmers encode and decode correctly (reverse complement)") { using salmon::utils::Direction; GIVEN("All 6-mers") { std::vector kmers = getAllWords(6); //KmerDist<6, std::atomic> kh; for (auto& k : kmers) { auto i = indexForKmer(k.c_str(), 6, Direction::REVERSE_COMPLEMENT); auto kp = kmerForIndex(i, 6); auto krc = rc(k); WHEN("kmer is [" + k + "]") { THEN("decodes as [" + kp + "]") { REQUIRE(krc == kp); } } } } } SCENARIO("The next k-mer index function works correctly") { using salmon::utils::Direction; const uint32_t K = 6; std::string s = "ATTCTCCACATAGTTGTCATCGAACCAGTACCCCGTAAGCGCCAACATAT"; GIVEN("The string " + s) { auto idx = indexForKmer(s.c_str(), 6, Direction::FORWARD); std::string k = s.substr(0, 6); WHEN("kmer is [" + k + "]") { auto kp = kmerForIndex(idx, 6); THEN("decodes as [" + kp + "]") { REQUIRE(k == kp); } } for (size_t i = 0; i < s.size() - K; ++i) { idx = nextKmerIndex(idx, s[i+K], 6, Direction::FORWARD); k = s.substr(i+1, 6); WHEN("kmer is [" + k + "]") { auto kp = kmerForIndex(idx, 6); THEN("decodes as [" + kp + "]") { REQUIRE(k == kp); } } } } //auto rcs = rc(s); GIVEN("The string " + s + " in the reverse complement direction") { auto idx = indexForKmer(s.c_str(), 6, Direction::REVERSE_COMPLEMENT); std::string k = rc(s.substr(0, 6)); WHEN("kmer is [" + k + "]") { auto kp = kmerForIndex(idx, 6); THEN("decodes as [" + kp + "]") { REQUIRE(k == kp); } } const char* seq = s.c_str(); for (size_t i = 0; i < s.size() - K; ++i) { idx = nextKmerIndex(idx, s[i+K], 6, Direction::REVERSE_COMPLEMENT); auto idx2 = indexForKmer(seq+i+1, 6, Direction::REVERSE_COMPLEMENT); k = rc(s.substr(i+1, 6)); WHEN("kmer is [" + k + "]") { auto kp = kmerForIndex(idx, 6); THEN("decodes as [" + kp + "]") { REQUIRE(k == kp); } THEN("incremental decoding works") { REQUIRE(idx == idx2); } } } } }