/* test/test-vcf-api.c -- VCF test harness. Copyright (C) 2013, 2014, 2017-2020 Genome Research Ltd. Author: Petr Danecek Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ #include #include #include #include #include "../htslib/hts.h" #include "../htslib/vcf.h" #include "../htslib/kstring.h" #include "../htslib/kseq.h" void error(const char *format, ...) { va_list ap; va_start(ap, format); vfprintf(stderr, format, ap); va_end(ap); if (strrchr(format, '\n') == NULL) fputc('\n', stderr); exit(-1); } #define STRINGIFY(x) #x #define check0(x) ((x) == 0 ? (void) 0 : error("Failed: %s", STRINGIFY(x))) static int check_alleles(bcf1_t *rec, const char **alleles, int num) { int i; if (rec->n_allele != num) { fprintf(stderr, "Wrong number of alleles - expected %d, got %d\n", num, rec->n_allele); return -1; } if (bcf_unpack(rec, BCF_UN_STR) != 0) return -1; for (i = 0; i < num; i++) { if (0 != strcmp(alleles[i], rec->d.allele[i])) { fprintf(stderr, "Mismatch for allele %d : expected '%s' got '%s'\n", i, alleles[i], rec->d.allele[i]); return -1; } } return 0; } static void test_update_alleles(bcf_hdr_t *hdr, bcf1_t *rec) { // Exercise bcf_update_alleles() a bit const char *alleles1[2] = { "G", "A" }; const char *alleles2[3] = { "C", "TGCA", "CATG" }; #define rep10(x) x x x x x x x x x x const char *alleles3[3] = { rep10("ATTCTAGATC"), "TGCA", rep10("CTATTATCTCTAATGACATG") }; #undef rep10 const char *alleles4[3] = { alleles3[2], NULL, alleles3[0] }; // Add some alleles check0(bcf_update_alleles(hdr, rec, alleles1, 2)); check0(check_alleles(rec, alleles1, 2)); // Erase them check0(bcf_update_alleles(hdr, rec, NULL, 0)); check0(check_alleles(rec, NULL, 0)); // Expand to three check0(bcf_update_alleles(hdr, rec, alleles2, 3)); check0(check_alleles(rec, alleles2, 3)); // Now try some bigger ones (should force a realloc) check0(bcf_update_alleles(hdr, rec, alleles3, 3)); check0(check_alleles(rec, alleles3, 3)); // Ensure it works even if one of the alleles points into the // existing structure alleles4[1] = rec->d.allele[1]; check0(bcf_update_alleles(hdr, rec, alleles4, 3)); alleles4[1] = alleles3[1]; // Will have been clobbered by the update check0(check_alleles(rec, alleles4, 3)); // Ensure it works when the alleles point into the existing data, // rec->d.allele is used to define the input array and the // order of the entries is changed. The result of this should // be the same as alleles2. char *tmp = rec->d.allele[0] + strlen(rec->d.allele[0]) - 4; rec->d.allele[0] = rec->d.allele[2] + strlen(rec->d.allele[2]) - 1; rec->d.allele[2] = tmp; check0(bcf_update_alleles(hdr, rec, (const char **) rec->d.allele, 3)); check0(check_alleles(rec, alleles2, 3)); } void write_bcf(char *fname) { // Init htsFile *fp = hts_open(fname,"wb"); if (!fp) error("Failed to open \"%s\" : %s", fname, strerror(errno)); bcf_hdr_t *hdr = bcf_hdr_init("w"); if (!hdr) error("bcf_hdr_init : %s", strerror(errno)); bcf1_t *rec = bcf_init1(); if (!rec) error("bcf_init1 : %s", strerror(errno)); // Check no-op on fresh bcf1_t check0(bcf_update_alleles(hdr, rec, NULL, 0)); // Create VCF header kstring_t str = {0,0,0}; check0(bcf_hdr_append(hdr, "##fileDate=20090805")); check0(bcf_hdr_append(hdr, "##FORMAT=")); check0(bcf_hdr_append(hdr, "##INFO=")); check0(bcf_hdr_append(hdr, "##FILTER=")); check0(bcf_hdr_append(hdr, "##unused=")); check0(bcf_hdr_append(hdr, "##unused=unformatted text 1")); check0(bcf_hdr_append(hdr, "##unused=unformatted text 2")); check0(bcf_hdr_append(hdr, "##contig=")); check0(bcf_hdr_append(hdr, "##source=myImputationProgramV3.1")); check0(bcf_hdr_append(hdr, "##reference=file:///seq/references/1000GenomesPilot-NCBI36.fasta")); check0(bcf_hdr_append(hdr, "##contig=")); check0(bcf_hdr_append(hdr, "##phasing=partial")); check0(bcf_hdr_append(hdr, "##INFO=")); check0(bcf_hdr_append(hdr, "##INFO=")); check0(bcf_hdr_append(hdr, "##INFO=")); check0(bcf_hdr_append(hdr, "##INFO=")); check0(bcf_hdr_append(hdr, "##INFO=")); check0(bcf_hdr_append(hdr, "##INFO=")); check0(bcf_hdr_append(hdr, "##INFO=")); check0(bcf_hdr_append(hdr, "##FILTER=")); check0(bcf_hdr_append(hdr, "##FILTER=")); check0(bcf_hdr_append(hdr, "##FORMAT=")); check0(bcf_hdr_append(hdr, "##FORMAT=")); check0(bcf_hdr_append(hdr, "##FORMAT=")); check0(bcf_hdr_append(hdr, "##FORMAT=")); check0(bcf_hdr_append(hdr, "##FORMAT=")); // Try a few header modifications bcf_hdr_remove(hdr, BCF_HL_CTG, "Unused"); check0(bcf_hdr_append(hdr, "##contig=")); bcf_hdr_remove(hdr, BCF_HL_FMT, "TS"); check0(bcf_hdr_append(hdr, "##FORMAT=")); bcf_hdr_remove(hdr, BCF_HL_INFO, "NEG"); check0(bcf_hdr_append(hdr, "##INFO=")); bcf_hdr_remove(hdr, BCF_HL_FLT, "s50"); check0(bcf_hdr_append(hdr, "##FILTER=")); check0(bcf_hdr_add_sample(hdr, "NA00001")); check0(bcf_hdr_add_sample(hdr, "NA00002")); check0(bcf_hdr_add_sample(hdr, "NA00003")); check0(bcf_hdr_add_sample(hdr, NULL)); // to update internal structures if ( bcf_hdr_write(fp, hdr)!=0 ) error("Failed to write to %s\n", fname); // Add a record // 20 14370 rs6054257 G A 29 PASS NS=3;DP=14;NEG=-127;AF=0.5;DB;H2 GT:GQ:DP:HQ 0|0:48:1:51,51 1|0:48:8:51,51 1/1:43:5:.,. // .. CHROM rec->rid = bcf_hdr_name2id(hdr, "20"); // .. POS rec->pos = 14369; // .. ID check0(bcf_update_id(hdr, rec, "rs6054257")); // .. REF and ALT test_update_alleles(hdr, rec); const char *alleles[2] = { "G", "A" }; check0(bcf_update_alleles_str(hdr, rec, "G,A")); check0(check_alleles(rec, alleles, 2)); // .. QUAL rec->qual = 29; // .. FILTER int32_t tmpi = bcf_hdr_id2int(hdr, BCF_DT_ID, "PASS"); check0(bcf_update_filter(hdr, rec, &tmpi, 1)); // .. INFO tmpi = 3; check0(bcf_update_info_int32(hdr, rec, "NS", &tmpi, 1)); tmpi = 500; check0(bcf_update_info_int32(hdr, rec, "DP", &tmpi, 1)); tmpi = 100000; check0(bcf_update_info_int32(hdr, rec, "DP", &tmpi, 1)); tmpi = 14; check0(bcf_update_info_int32(hdr, rec, "DP", &tmpi, 1)); tmpi = -127; check0(bcf_update_info_int32(hdr, rec, "NEG", &tmpi, 1)); float tmpf = 0.5; check0(bcf_update_info_float(hdr, rec, "AF", &tmpf, 1)); check0(bcf_update_info_flag(hdr, rec, "DB", NULL, 1)); check0(bcf_update_info_flag(hdr, rec, "H2", NULL, 1)); // .. FORMAT int32_t *tmpia = (int*)malloc(bcf_hdr_nsamples(hdr)*2*sizeof(int)); tmpia[0] = bcf_gt_phased(0); tmpia[1] = bcf_gt_phased(0); tmpia[2] = bcf_gt_phased(1); tmpia[3] = bcf_gt_phased(0); tmpia[4] = bcf_gt_unphased(1); tmpia[5] = bcf_gt_unphased(1); check0(bcf_update_genotypes(hdr, rec, tmpia, bcf_hdr_nsamples(hdr)*2)); tmpia[0] = 48; tmpia[1] = 48; tmpia[2] = 43; check0(bcf_update_format_int32(hdr, rec, "GQ", tmpia, bcf_hdr_nsamples(hdr))); tmpia[0] = 0; tmpia[1] = 0; tmpia[2] = 1; check0(bcf_update_format_int32(hdr, rec, "DP", tmpia, bcf_hdr_nsamples(hdr))); tmpia[0] = 1; tmpia[1] = 100000; tmpia[2] = 1; check0(bcf_update_format_int32(hdr, rec, "DP", tmpia, bcf_hdr_nsamples(hdr))); tmpia[0] = 1; tmpia[1] = 8; tmpia[2] = 5; check0(bcf_update_format_int32(hdr, rec, "DP", tmpia, bcf_hdr_nsamples(hdr))); tmpia[0] = 51; tmpia[1] = 51; tmpia[2] = 51; tmpia[3] = 51; tmpia[4] = bcf_int32_missing; tmpia[5] = bcf_int32_missing; check0(bcf_update_format_int32(hdr, rec, "HQ", tmpia, bcf_hdr_nsamples(hdr)*2)); char *tmp_str[] = {"String1","SomeOtherString2","YetAnotherString3"}; check0(bcf_update_format_string(hdr, rec, "TS", (const char**)tmp_str, 3)); tmp_str[0] = "LongerStringRequiringBufferReallocation"; check0(bcf_update_format_string(hdr, rec, "TS", (const char**)tmp_str, 3)); tmp_str[0] = "String1"; check0(bcf_update_format_string(hdr, rec, "TS", (const char**)tmp_str, 3)); if ( bcf_write1(fp, hdr, rec)!=0 ) error("Failed to write to %s\n", fname); // 20 1110696 . A G,T 67 . NS=2;DP=10;NEG=-128;AF=0.333,.;AA=T;DB GT 2 1 ./. bcf_clear1(rec); rec->rid = bcf_hdr_name2id(hdr, "20"); rec->pos = 1110695; check0(bcf_update_alleles_str(hdr, rec, "A,G,T")); rec->qual = 67; tmpi = 2; check0(bcf_update_info_int32(hdr, rec, "NS", &tmpi, 1)); tmpi = 10; check0(bcf_update_info_int32(hdr, rec, "DP", &tmpi, 1)); tmpi = -128; check0(bcf_update_info_int32(hdr, rec, "NEG", &tmpi, 1)); float *tmpfa = (float*)malloc(2*sizeof(float)); tmpfa[0] = 0.333; bcf_float_set_missing(tmpfa[1]); check0(bcf_update_info_float(hdr, rec, "AF", tmpfa, 2)); check0(bcf_update_info_string(hdr, rec, "AA", "SHORT")); check0(bcf_update_info_string(hdr, rec, "AA", "LONGSTRING")); check0(bcf_update_info_string(hdr, rec, "AA", "T")); check0(bcf_update_info_flag(hdr, rec, "DB", NULL, 1)); tmpia[0] = bcf_gt_phased(2); tmpia[1] = bcf_int32_vector_end; tmpia[2] = bcf_gt_phased(1); tmpia[3] = bcf_int32_vector_end; tmpia[4] = bcf_gt_missing; tmpia[5] = bcf_gt_missing; check0(bcf_update_genotypes(hdr, rec, tmpia, bcf_hdr_nsamples(hdr)*2)); if ( bcf_write1(fp, hdr, rec)!=0 ) error("Failed to write to %s\n", fname); free(tmpia); free(tmpfa); // Clean free(str.s); bcf_destroy1(rec); bcf_hdr_destroy(hdr); int ret; if ( (ret=hts_close(fp)) ) { fprintf(stderr,"hts_close(%s): non-zero status %d\n",fname,ret); exit(ret); } } void bcf_to_vcf(char *fname) { htsFile *fp = hts_open(fname,"rb"); if (!fp) error("Failed to open \"%s\" : %s", fname, strerror(errno)); bcf_hdr_t *hdr = bcf_hdr_read(fp); if (!hdr) error("bcf_hdr_read : %s", strerror(errno)); bcf1_t *rec = bcf_init1(); if (!rec) error("bcf_init1 : %s", strerror(errno)); char *gz_fname = (char*) malloc(strlen(fname)+4); if (!gz_fname) error("malloc : %s", strerror(errno)); snprintf(gz_fname,strlen(fname)+4,"%s.gz",fname); htsFile *out = hts_open(gz_fname,"wg"); if (!out) error("Couldn't open \"%s\" : %s\n", gz_fname, strerror(errno)); bcf_hdr_t *hdr_out = bcf_hdr_dup(hdr); bcf_hdr_remove(hdr_out,BCF_HL_STR,"unused"); bcf_hdr_remove(hdr_out,BCF_HL_GEN,"unused"); bcf_hdr_remove(hdr_out,BCF_HL_FLT,"Flt"); bcf_hdr_remove(hdr_out,BCF_HL_INFO,"UI"); bcf_hdr_remove(hdr_out,BCF_HL_FMT,"UF"); bcf_hdr_remove(hdr_out,BCF_HL_CTG,"Unused"); if ( bcf_hdr_write(out, hdr_out)!=0 ) error("Failed to write to %s\n", fname); int r; while ((r = bcf_read1(fp, hdr, rec)) >= 0) { if ( bcf_write1(out, hdr_out, rec)!=0 ) error("Failed to write to %s\n", fname); // Test problems caused by bcf1_sync: the data block // may be realloced, also the unpacked structures must // get updated. check0(bcf_unpack(rec, BCF_UN_STR)); check0(bcf_update_id(hdr, rec, 0)); check0(bcf_update_format_int32(hdr, rec, "GQ", NULL, 0)); bcf1_t *dup = bcf_dup(rec); // force bcf1_sync call if ( bcf_write1(out, hdr_out, dup)!=0 ) error("Failed to write to %s\n", fname); bcf_destroy1(dup); check0(bcf_update_alleles_str(hdr_out, rec, "G,A")); int32_t tmpi = 99; check0(bcf_update_info_int32(hdr_out, rec, "DP", &tmpi, 1)); int32_t tmpia[] = {9,9,9}; check0(bcf_update_format_int32(hdr_out, rec, "DP", tmpia, 3)); if ( bcf_write1(out, hdr_out, rec)!=0 ) error("Failed to write to %s\n", fname); } if (r < -1) error("bcf_read1"); bcf_destroy1(rec); bcf_hdr_destroy(hdr); bcf_hdr_destroy(hdr_out); int ret; if ( (ret=hts_close(fp)) ) { fprintf(stderr,"hts_close(%s): non-zero status %d\n",fname,ret); exit(ret); } if ( (ret=hts_close(out)) ) { fprintf(stderr,"hts_close(%s): non-zero status %d\n",gz_fname,ret); exit(ret); } // read gzip, write stdout htsFile *gz_in = hts_open(gz_fname, "r"); if ( !gz_in ) { fprintf(stderr,"Could not read: %s\n", gz_fname); exit(1); } kstring_t line = {0,0,0}; while ( hts_getline(gz_in, KS_SEP_LINE, &line)>0 ) { kputc('\n',&line); fwrite(line.s,1,line.l,stdout); } if ( (ret=hts_close(gz_in)) ) { fprintf(stderr,"hts_close(%s): non-zero status %d\n",gz_fname,ret); exit(ret); } free(line.s); free(gz_fname); } void iterator(const char *fname) { htsFile *fp = hts_open(fname, "r"); if (!fp) error("Failed to open \"%s\" : %s", fname, strerror(errno)); bcf_hdr_t *hdr = bcf_hdr_read(fp); if (!hdr) error("bcf_hdr_read : %s", strerror(errno)); hts_idx_t *idx; hts_itr_t *iter; bcf_index_build(fname, 0); idx = bcf_index_load(fname); iter = bcf_itr_queryi(idx, bcf_hdr_name2id(hdr, "20"), 1110600, 1110800); bcf_itr_destroy(iter); iter = bcf_itr_querys(idx, hdr, "20:1110600-1110800"); bcf_itr_destroy(iter); hts_idx_destroy(idx); bcf_hdr_destroy(hdr); int ret; if ( (ret=hts_close(fp)) ) { fprintf(stderr,"hts_close(%s): non-zero status %d\n",fname,ret); exit(ret); } } void test_get_info_values(const char *fname) { htsFile *fp = hts_open(fname, "r"); if (!fp) error("Failed to open \"%s\" : %s", fname, strerror(errno)); bcf_hdr_t *hdr = bcf_hdr_read(fp); if (!hdr) error("bcf_hdr_read : %s", strerror(errno)); bcf1_t *line = bcf_init(); if (!line) error("bcf_init : %s", strerror(errno)); int r; while ((r = bcf_read(fp, hdr, line)) == 0) { float *afs = 0; int32_t *negs = NULL; int count = 0; int ret = bcf_get_info_float(hdr, line, "AF", &afs, &count); if (line->pos == 14369) { if (ret != 1 || afs[0] != 0.5f) { fprintf(stderr, "AF on position 14370 should be 0.5\n"); exit(-1); } } else { if (ret != 2 || afs[0] != 0.333f || !bcf_float_is_missing(afs[1])) { fprintf(stderr, "AF on position 1110696 should be 0.333, missing\n"); exit(-1); } } free(afs); int32_t expected = (line->pos == 14369)? -127 : -128; count = 0; ret = bcf_get_info_int32(hdr, line, "NEG", &negs, &count); if (ret != 1 || negs[0] != expected) { if (ret < 0) fprintf(stderr, "NEG should be %d, got error ret=%d\n", expected, ret); else if (ret == 0) fprintf(stderr, "NEG should be %d, got no entries\n", expected); else fprintf(stderr, "NEG should be %d, got %d entries (first is %d)\n", expected, ret, negs[0]); exit(1); } free(negs); } if (r < -1) error("bcf_read"); bcf_destroy(line); bcf_hdr_destroy(hdr); hts_close(fp); } void write_format_values(const char *fname) { // Init htsFile *fp = hts_open(fname, "wb"); if (!fp) error("Failed to open \"%s\" : %s", fname, strerror(errno)); bcf_hdr_t *hdr = bcf_hdr_init("w"); if (!hdr) error("bcf_hdr_init : %s", strerror(errno)); bcf1_t *rec = bcf_init1(); if (!rec) error("bcf_init1 : %s", strerror(errno)); // Create VCF header check0(bcf_hdr_append(hdr, "##contig=")); check0(bcf_hdr_append(hdr, "##FORMAT=")); check0(bcf_hdr_add_sample(hdr, "S")); check0(bcf_hdr_add_sample(hdr, NULL)); // to update internal structures if ( bcf_hdr_write(fp, hdr)!=0 ) error("Failed to write to %s\n", fname); // Add a record // .. FORMAT float test[4]; bcf_float_set_missing(test[0]); test[1] = 47.11f; bcf_float_set_vector_end(test[2]); test[3] = -1.2e-13; check0(bcf_update_format_float(hdr, rec, "TF", test, 4)); if ( bcf_write1(fp, hdr, rec)!=0 ) error("Failed to write to %s\n", fname); bcf_destroy1(rec); bcf_hdr_destroy(hdr); int ret; if ((ret = hts_close(fp))) { fprintf(stderr, "hts_close(%s): non-zero status %d\n", fname, ret); exit(ret); } } void check_format_values(const char *fname) { htsFile *fp = hts_open(fname, "r"); bcf_hdr_t *hdr = bcf_hdr_read(fp); bcf1_t *line = bcf_init(); while (bcf_read(fp, hdr, line) == 0) { float *values = 0; int count = 0; int ret = bcf_get_format_float(hdr, line, "TF", &values, &count); // NOTE the return value from bcf_get_format_float is different from // bcf_get_info_float in the sense that vector-end markers also count. if (ret != 4 || count < ret || !bcf_float_is_missing(values[0]) || values[1] != 47.11f || !bcf_float_is_vector_end(values[2]) || !bcf_float_is_vector_end(values[3])) { fprintf(stderr, "bcf_get_format_float didn't produce the expected output.\n"); exit(-1); } free(values); } bcf_destroy(line); bcf_hdr_destroy(hdr); hts_close(fp); } void test_get_format_values(const char *fname) { write_format_values(fname); check_format_values(fname); } void test_invalid_end_tag(void) { static const char vcf_data[] = "data:," "##fileformat=VCFv4.1\n" "##contig=\n" "##INFO=\n" "#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO\n" "X\t86470037\trs59780433a\tTTTCA\tTGGTT,T\t.\t.\tEND=85725113\n" "X\t86470038\trs59780433b\tT\tTGGTT,T\t.\t.\tEND=86470047\n"; htsFile *fp; bcf_hdr_t *hdr; bcf1_t *rec; int ret; int32_t tmpi; enum htsLogLevel logging = hts_get_log_level(); // Silence warning messages hts_set_log_level(HTS_LOG_ERROR); fp = hts_open(vcf_data, "r"); if (!fp) error("Failed to open vcf data : %s", strerror(errno)); rec = bcf_init1(); if (!rec) error("Failed to allocate BCF record : %s", strerror(errno)); hdr = bcf_hdr_read(fp); if (!hdr) error("Failed to read BCF header : %s", strerror(errno)); check0(bcf_read(fp, hdr, rec)); // rec->rlen should ignore the bogus END tag value on the first read if (rec->rlen != 5) { error("Incorrect rlen - expected 5 got %"PRIhts_pos"\n", rec->rlen); } check0(bcf_read(fp, hdr, rec)); // While on the second it should use it if (rec->rlen != 10) { error("Incorrect rlen - expected 10 got %"PRIhts_pos"\n", rec->rlen); } // Try to break it - will change rlen tmpi = 85725113; check0(bcf_update_info_int32(hdr, rec, "END", &tmpi, 1)); if (rec->rlen != 1) { error("Incorrect rlen - expected 1 got %"PRIhts_pos"\n", rec->rlen); } ret = bcf_read(fp, hdr, rec); if (ret != -1) { error("Unexpected return code %d from bcf_read at EOF", ret); } bcf_destroy1(rec); bcf_hdr_destroy(hdr); ret = hts_close(fp); if (ret != 0) { error("Unexpected return code %d from hts_close", ret); } hts_set_log_level(logging); } void test_open_format() { char mode[5]; int ret; strcpy(mode, "r"); ret = vcf_open_mode(mode+1, "mode1.bcf", NULL); if (strncmp(mode, "rb", 2) || ret) error("Mode '%s' does not match the expected value '%s'", mode, "rb"); mode[1] = 0; ret = vcf_open_mode(mode+1, "mode1.vcf", NULL); if (strncmp(mode, "r", 1) || ret) error("Mode '%s' does not match the expected value '%s'", mode, "r"); mode[1] = 0; ret = vcf_open_mode(mode+1, "mode1.vcf.gz", NULL); if (strncmp(mode, "rz", 2) || ret) error("Mode '%s' does not match the expected value '%s'", mode, "rz"); mode[1] = 0; ret = vcf_open_mode(mode+1, "mode1.vcf.bgz", NULL); if (strncmp(mode, "rz", 2) || ret) error("Mode '%s' does not match the expected value '%s'", mode, "rz"); mode[1] = 0; ret = vcf_open_mode(mode+1, "mode1.xcf", NULL); if (!ret) error("Expected failure for wrong extension 'xcf'"); mode[1] = 0; ret = vcf_open_mode(mode+1, "mode1.vcf.gbz", NULL); if (!ret) error("Expected failure for wrong extension 'vcf.gbz'"); mode[1] = 0; ret = vcf_open_mode(mode+1, "mode1.bvcf.bgz", NULL); if (!ret) error("Expected failure for wrong extension 'vcf.bvcf.bgz'"); } int main(int argc, char **argv) { char *fname = argc>1 ? argv[1] : "rmme.bcf"; // format test. quiet unless there's a failure test_get_format_values(fname); // main test. writes to stdout write_bcf(fname); bcf_to_vcf(fname); iterator(fname); // additional tests. quiet unless there's a failure. test_get_info_values(fname); test_invalid_end_tag(); test_open_format(); return 0; }