/* SequenceViewer.java * * created: Sat Dec 19 1998 * * This file is part of Artemis * * Copyright (C) 1998,1999,2000 Genome Research Limited * * This program is free software; you can redistribute it and/or * modify it under the terms of the GNU General Public License * as published by the Free Software Foundation; either version 2 * of the License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. * * You should have received a copy of the GNU General Public License * along with this program; if not, write to the Free Software * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA. * * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/SequenceViewer.java,v 1.1 2004-06-09 09:47:47 tjc Exp $ */ package uk.ac.sanger.artemis.components; import java.awt.Color; import java.awt.event.ActionEvent; import java.awt.event.ActionListener; import java.io.StringWriter; import java.io.PrintWriter; import java.util.Enumeration; import java.util.Hashtable; import java.util.regex.Matcher; import java.util.regex.Pattern; import javax.swing.ButtonGroup; import javax.swing.JMenu; import javax.swing.JMenuBar; import javax.swing.JRadioButtonMenuItem; import javax.swing.text.Style; import javax.swing.text.StyleConstants; import javax.swing.text.StyledDocument; /** * This component provides a viewer for dna or amino acid sequences. The * units are numbered automatically, given a view like this: *
* ATGATGATGATGATATGCATGATCG * 10 20 ** @author Kim Rutherford * @version $Id: SequenceViewer.java,v 1.1 2004-06-09 09:47:47 tjc Exp $ **/ public class SequenceViewer extends FileViewer { /** * Create a new SequenceViewer component. * @param title The name to attach to the new JFrame. * @param include_numbers If true then the sequence will be numbered * (every second line of the display will be numbers rather than * sequence). **/ public SequenceViewer (final String title, final boolean include_numbers) { super (title, true, false, true); this.include_numbers = include_numbers; initMenu(); } private void initMenu() { final JMenuBar mBar = getJMenuBar(); final JMenu viewMenu = new JMenu("View"); mBar.add(viewMenu); final ButtonGroup group = new ButtonGroup(); final JRadioButtonMenuItem none = new JRadioButtonMenuItem("No Colour"); none.addActionListener(new ActionListener() { public void actionPerformed(ActionEvent arg0) { if(none.isSelected()) clearColour(); } }); viewMenu.add(none); group.add(none); final JRadioButtonMenuItem taylor = new JRadioButtonMenuItem("Taylor Colour"); taylor.addActionListener(new ActionListener() { public void actionPerformed(ActionEvent arg0) { if(taylor.isSelected()) colourTaylor(); } }); viewMenu.add(taylor); group.add(taylor); final JRadioButtonMenuItem rasmol = new JRadioButtonMenuItem("Rasmol Colour"); rasmol.addActionListener(new ActionListener() { public void actionPerformed(ActionEvent e) { colourRasmol(); } }); viewMenu.add(rasmol); group.add(rasmol); final JRadioButtonMenuItem stops = new JRadioButtonMenuItem("Stop Codon Colour"); stops.addActionListener(new ActionListener() { public void actionPerformed(ActionEvent e) { colourStops(); } }); viewMenu.add(stops); group.add(stops); final JRadioButtonMenuItem nuc = new JRadioButtonMenuItem("Nucleotide Colour"); nuc.addActionListener(new ActionListener() { public void actionPerformed(ActionEvent e) { colourNuc(); } }); viewMenu.add(nuc); group.add(nuc); stops.setSelected(true); // add clear style final Style style = getTextPane().addStyle("clear", null); StyleConstants.setBackground(style, Color.white); } /** * Set the sequence to display. * @param comment_line A comment to put on the first line. This may be * null in which case there is no comment line. This String should not * be "\n" terminated. * @param sequence The sequence to display. This may be null in which case * there is no comment line. This String should not be "\n" terminated. **/ public void setSequence (final String comment_line, final String sequence) { this.comment_line = comment_line; this.sequence = sequence; setView (); } /** * Set the sequence to display with no comment line. * @param sequence The sequence to display. This may be null in which case * there is no comment line. This String should not be "\n" terminated. **/ public void setSequence (final String sequence) { this.comment_line = null; this.sequence = sequence; setView (); } /** * Write the sequence and comment_line in the view. **/ private void setView () { final StringWriter string_writer = new StringWriter (); final PrintWriter writer = new PrintWriter (string_writer); if (comment_line != null) { writer.println (comment_line); } String rest_of_sequence = sequence; final int UNITS_PER_LINE = 60; int line_count = 0; while (rest_of_sequence != null) { final String this_line; if (rest_of_sequence.length () < UNITS_PER_LINE) { this_line = rest_of_sequence; rest_of_sequence = null; } else { this_line = rest_of_sequence.substring (0, UNITS_PER_LINE); rest_of_sequence = rest_of_sequence.substring (UNITS_PER_LINE); } writer.println (this_line); if (include_numbers) { final int COUNT_INTERVAL = 10; for (int i = 1 ; i <= this_line.length () / COUNT_INTERVAL; ++i) { final int this_unit_count = i * COUNT_INTERVAL + line_count * UNITS_PER_LINE; final int number_of_spaces = COUNT_INTERVAL - String.valueOf (this_unit_count).length (); for (int space_index = 0 ; space_index < number_of_spaces ; ++space_index) { writer.print (' '); } writer.print (this_unit_count); } writer.println (); } ++line_count; } writer.flush (); setText (string_writer.toString ()); colourStops(); } private void colourStops() { clearColour(); final StyledDocument doc = getTextPane().getStyledDocument(); final Style style = getTextPane().addStyle("Red", null); StyleConstants.setBackground(style, Color.red); final Matcher matcher = STOP_CODON_PATTERN.matcher(getText()); while( matcher.find() ) { doc.setCharacterAttributes(matcher.start(), matcher.end()-matcher.start(), getTextPane().getStyle("Red"), true); } } /** * Use Taylor colour scheme * W.R.Taylor Protein Eng. vol.10 no. 7 pp743-746, 1997 */ private void colourTaylor() { clearColour(); applyColourScheme(org.emboss.jemboss.editor.SequenceProperties.taylorColor); } /** * Use Rasmol colour scheme */ private void colourRasmol() { clearColour(); applyColourScheme(org.emboss.jemboss.editor.SequenceProperties.rasmolColor); } /** * Use Rasmol colour scheme */ private void colourNuc() { clearColour(); applyColourScheme(org.emboss.jemboss.editor.SequenceProperties.baseColor); } private void applyColourScheme(final Hashtable