The fasta format contains one line header which is followed by lines of sequence data. The header line starts with the symbol > as the first character. The first word following the > character is the name of the sequence, followed by a description of the sequence. The remaining lines contain the sequence itself. Here is an example:

---

> seq1Name This is the description of my first sequence.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC
> seq2Name This is the description of my second sequence.
CGATCGATCGTACGTCGACTGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG