/* @(#)help.wrm 1.1 1/20/94 */ /***************************************************************/ /***************************************************************/ /** File wspec/help.wrm : **/ /** Provides an online help for the ACeDB program. **/ /***************************************************************/ /***************************************************************/ /* */ /* R.Durbin & J.Thierry-Mieg. */ /* last modified 22/9/91 by JTM. */ /* */ /***************************************************************/ **acedb ************************************************************** **** acedb: A C. elegans Database **** **** Richard Durbin (MRC, UK) rd@mrc-lmba.cam.ac.uk **** **** Jean Thierry-Mieg (CNRS, France) mieg@kaa.cnrs-mop.fr**** ************************************************************** This help page provides basic information for the whole program. For specific help on the Main Window press the "Page Down" button. Exit: To exit the program choose Quit from the menu in the main window. Help: The F1 or F10 or Help key invokes the on line help related to the window to which the mouse points. Some of these keys may not work on some machines or under some window managers, but one should! There is also a help entry in most menus. Printing: The F2 or F9 key creates a post-script file in the subdirectory PS of $ACEDB. It will then try to print it using "lpr". If the environment variable ACEDB_LPR is set (e.g. setenv ACEDB_LPR "lpr -Pmyprinter"), then that print command is used instead. Setting it to an empty string will prevent automatic printing. There is also a print option in most menus. Color, Gray, Black and White screens: In principle, under X11, acedb will autodetect the type of screen you are using. In case of problem, you can try to setenv one of ACEDB_MONO, ACEDB_GREY, ACEDB_GRAY, ACEDB_COLOR, ACEDB_COLOUR. Mouse: The left button is used to pick windows or objects. Usually, picking once changes the color of the box, picking a second time initiates and action. The mid button is used in some graphic windows to recenter (single click) or to zoom and recenter (by dragging in horizontal and vertical directions). On the Next, press both buttons to emulate the mid button. The right button is used to access menus. Menu: Under X windows (Openwin) you get the menu for any acedb window by pressing the right mouse button when the cursor is in the window. Under SunView you must press the right mouse button when the cursor is in the title bar of the window. Text entry boxes: The yellow and green boxes are micro text editors. Only one of them is active (yellow) in a given window. To activate one, pick it with the left mouse button, this will position the cursor. Recognised commands are: Return key, Insert key (a toggle), Delete and BackSpace keys, Home and End key, the left and right arrows, a set of usual control keys to move (^f: forward, ^b: backward, ^a: to beginning, ^e: to end of line) and delete (^d: a char, ^w: a word, ^k: to end of line, ^u: whole line) and Tab which autocompletes the names when the class is known. General info: The release number is available using Status in the main menu. You may redistribute this program and database subject to the conditions in the following copyright notice. Anyone interested in maintaining an up to date version should contact one of the authors at the above email addresses. /* Copyright (C) 1991 R Durbin and J Thierry-Mieg. All rights reserved. * Written by Jean Thierry Mieg and Richard Durbin, 1990, 1991. * Redistribution and use in source and binary forms are freely * permitted provided that the above copyright notice and * attribution and date of work and this paragraph are duplicated * in all such forms and that neither this software nor software * based in whole or in part on this software is sold for profit. * THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR * IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED * WARRANTIES OF MERCHANTIBILITY AND FITNESS FOR A PARTICULAR * PURPOSE. */ ################################################################# **Main_Window For general information about the program, how to get on line help, how to use the mouse, how to print windows, authorship, distribution, copyright etc, press the page_up button. ** To exit the program choose Quit from the menu in the main window. ** The main window lets you find objects in the database in two different ways: (1) You can pick a class by clicking with the left mouse button. Clicking again will give a list of all objects in that class in the Selection Window. You can restrict this list by typing a template in the Template box. When you press the Return key you activate the search. Name recognition is not case sensitive. A '*' in the template will match anything; e.g. "S*" will match all names beginning with 'S', "*S*" will match all names containing an 'S', "*a*b" all names containing an 'A' and ending with a 'B'. To actually display the object you must pick its names twice in the Selection Window (see help for Selection Window). (2) You can type a text string in the Text Search box (first click on it with the left button to make it yellow). This will find all the objects in the database which contain the search text. More precisely, we find all objects whose name contains the search string, all objects they refer to, and all containing Text (or other X class data) containing the search string. In addition the Main Window menu allows access to many other applications and functions of acedb. Menu entries: Quit Quits entire program Help Gets the on line Help Program Status Info on the database Clean up Kills all acedb windows except main Add update file To read the official data updates Query Starts a window which has its own help. Deficiencies Primitive tool to analyse deficiency data. Genetics Run the get buttons to preprocess Mapping data DNA Starts a window which has its own help. Wild Worms Starts an OPEN-WINDOWS screen saver if available Toggle entry (you only see one of these at a time) Write Access Select this to get write access to the database. If you are not registered in wspec/passwd, you will not be offered this option. Save Saves all changes permanently and releases write access. The following entries only exist if you have Super-User access Add/Alias/Rename Starts a window which has its own help. Read .ace files Starts a window which has its own help. Align maps Starts a window which has its own help. Read Models Run this after modifying wspec/models.wrm Dump asn models Produces an asn definition file. Dump Dumps the whole databse in ace format. Slow. Debugger Calls the function "invokeDebugger()", set a break on this function in your favorite debugger. Test subroutine Calls acedbtest(), for use to test new code. ################################################################# **Tacedb ************************************************************** **** acedb: A C. elegans Database **** **** Richard Durbin (MRC, UK) rd@mrc-lmba.cam.ac.uk **** **** Jean Thierry-Mieg (CNRS, France) mieg@kaa.cnrs-mop.fr**** ************************************************************** This help page provides basic information for the line oriented version of the acedb program. Exit: To exit the program type Quit, or simply q Help: Type ?, or help, or help topic. You may redistribute this program and database subject to the conditions in the following copyright notice. Anyone interested in maintaining an up to date version should contact one of the authors at the above email addresses. /* Copyright (C) 1991 R Durbin and J Thierry-Mieg. All rights reserved. * Written by Jean Thierry Mieg and Richard Durbin, 1990, 1991. * Redistribution and use in source and binary forms are freely * permitted provided that the above copyright notice and * attribution and date of work and this paragraph are duplicated * in all such forms and that neither this software nor software * based in whole or in part on this software is sold for profit. * THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR * IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED * WARRANTIES OF MERCHANTIBILITY AND FITNESS FOR A PARTICULAR * PURPOSE. */ ################################################################# **Help The online help is in the file wspec/help.wrm Each sections of the help menu starts by **section_name To register a help section with a display, just edit the file wspec/displays.wrm, do not recompile. Menu: Gives the table of content. Page Up : Page Down : Let you read the help file in consecutive order. Push: Enter the section in the help ring. Pop: Circle backwards around the help ring. This ring contains the page accessed automatically from another window, those picked from the menu and those explicitly pushed into the ring. Not those you have been browsing through using page up/down. The ring is reinitialised if you kill the help window. ################################################################# **File_Chooser Interactive File Chooser You can type a directory name in the top box and a file template in the second and third box. Or pick them from the current list which appears underneath. ################################################################# **No_help For this display, no help was specified in wspec/displays.wrm ################################################################# **Chronometer Integrated profiler. This profiler will run only if the code is compiled with the option -DCHRONO (see in the file wmake/truemake) and will only profile those functions which include a balanced pair of calls chronoStart("Function name") ; chronoReturn() ; To use it open the Chronometer from the main menu, pick Start from the chrono menu do whatever you want, i.e. parse a file, may be interspacing your work with commands Start and Stop from the chrono menu when you are done pick Show from the chrono menu Print will copy the content of the chrono window to ./PS/chronometer#.PS or simply ./chronometer#.PS if you do not have a PS subdirectory in your current directory. This output is in PostScript. ################################################################# **Status Displays information about the usage of the memory and the disk. The first line indicates explicitly the session number, this number is updated whenever new data are entered and saved, the login name of the user, and his present write access state. The line On disk concerns the file database/blocks.wrm It indicates the number of blocks really used by the database, followed by the number of blocks still available. You may want to monitor these figures from time to time. The number of used blocks should grow substantially only when you parse a lot of new data or when you multiply the number of different sessions kept available. It should decrease when you destroy old sessions. If at some point this file becomes full, the program will ask permission to extend it as needed. If you refuse, the current session will be lost and you will simply restart on the statu quo ante. The number of lexiques corresponds to the number of different classes as defined in wspec/classes.wrm. The number of keys is the number of independent objects known to the database, the number of char is the cumulated length of their names and of the entries in class Text. The number of nodes and arrays gives an indication on the usage of the memory. They may be useful to debug a new piece of code and check, for example that all the arrays created for a given purpose get destroyed when they should. You should have used objects = locked + known and locked droping to zero after a clean up The number of modified objects should drop to 0 after a *Save. In the local menu you will find Quit Destroys the window. Help Invoke this page of the present file. Update Refreshes the data displayed in the status window More on lexiques shows how many objects there are in each class BlockShow Gives some detail on the content of the first cache This info is only useful to debug or optimize the kernel of the acedb program. ################################################################# **Cloning Hopefully, this will turn into a full fledged tool to recompute the physical map and assess its reliability. At present, it does very little. This option is not linked in release 1.4 Select project: This will look for a binary file $ACEDB_DATA/sulston/whatever_you_enter.bnd if it does not exist the program will try to create it from the ascii file $ACEDB_DATA/sulston/whatever_you_enter.cor which should contain the rawdata of the physical map, one integer by line Histogram: Plots the histogram of the raw data just read. Calcul: Does nothing interesting yet (jan 1991), sorry. #################################################################### **Linear_correlation A small utility to compute and plot a linear regression The prototype is : typedef struct point {double x, y ;} Point ; void plotCorrel(char *title, Array a) Print; outputs the window as usual to ./PS/correl#.PS Statistics: Not yet available. Sorry. Should hopefully give likelihoods of the regression. #################################################################### **Genetics A tool to compute the genetic map. Still in embryonic form, sorry. Not linked in release 1.4 #################################################################### **Add_New_Objects This window lets you perform various operations on whole objects. Currently you add new objects, delete entire objects, and rename objects. You must have acquired write access for it to work. First choose the class that you want to add to by picking on it. Then type the name of the object in the text entry box, then select the operation you want to perform from the menu. If you hit return and the object already exists it is displayed in tree mode (useful for confirming before renaming or destroying). Double clicking on the classes does nothing. All actions are initiated from the menu. Menu items: Create: creates a new entry and displays and empty tree window for it so you can get update mode and add data if you want. Rename/Fuse: prompts for a new name. Fuse does not work yet. Delete: deletes object with all its data #################################################################### **KeySet Selecting a class in the acedb Main Window pops up a selection list. It contains a list of keys which can be manipulated in many ways. You can select any displayed key by clicking it with the left mouse button, it then reverts color. If you select it a second time (double click without time-out), the corresponding object is popped if it is known in the database. A clone will be displayed as part of the physical map, a chromosome as a genetic map, most other objects as text trees. You can overide this display type by selecting it (one click) and choosing one of the options Tree or Dump from the local menu. Quit: Destroys the window. Help: Invoke this page of the present file. Add Key: lets you add a key to the current list by picking. You can build up a heterogeneous list of object keys, e.g. for dumping, this way. Copy: Copies the selection list to a new window. You should use this option to save the result of a previous selection before reactivating the Main Window. Save: Saves the selection list as a new permanent object belonging to the class KeySet. AND: OR: XOR: You must first pick with the left mouse button the background of another keySet window. Then these 3 options will perform the logical mix of your window and the other one and present the result in the former. AND takes the intersection of the 2 sets, OR their union. XOR is the exclusive OR. Ace Dump: Dumps all the selected objects into ascii file in the .ace format that you or some program (including acedb itself) can read. This file could be transfered over the network and read by the acedb program on another machine. Also it is a convenient way to make a standard file containing the information in acedb about a set of objects. Name Dump: Dumps the current list as a KeySet object (ace format). FastA dump: this creates a file of DNA sequence data in the standard fastA format containing sequence for all objects in the current list with DNA sequence attached. All the Dump options prompt you for a file name in an interactive window. Tree: Displays the object as a text Tree if possible, as opposed to displaying it in its default display type (possibly graphic). This is useful to enter comments or update the objects by hand in some other way. Biblio: Pops a window with all the papers related to the selected list : the paper themselves which are part of the list, those written by the authors of the list, those quoting the genes of the list, etc. The Biblio window can then be printed. Debug: Interpreted binary dump of the relevant disk blocks. Only useful to debug the kernel if need be. No documentation provided, contact the authors and/or study the directories w5 and w6. ################################################################### **Query Loads and execute external programs which sift through the data. The idea is to prepare in a directory $ACEDB/wquery a set of program files named xxx.qry containing sets of useful commands for selecting data. The syntax of the acedb query language is a little complex but quite powerful. It is explained in the Query_syntax help section and in the latex document doc/query_syntax, and allows you to write command files with parameters. An easier, but less powerful, interface is provided by the Query_Builder, and Query_by_example which can be acessed from the main acedb menu. The related Table_Maker allows the contruction of relational tables. ######################## The Buttons have the following options : ######################## Quit: Quits this window with an option to save your current file of commands, provided you have given a file name. Help: Invokes this section of the help file. Print: Print this window to a postscript file and send to printer (ACEDB_LPR). Clear: Clears all the user-entry boxes on the window. New KeySet: Calls up a new, blank keyset window titled "Query Answer". By Example: Call up the Query-by-example window. Builder: Call up the Query Builder window. Load: Loads the file Directory/FileName.qry if it exists. The ending .qry is added automatically Save: Saves the present set of commands into the file Directory/FileName.qry if you have write access to Directory. The ending .qry is added automatically Search Locally: Execute the current query on the local database and put the found and selected objects in the Keyset (selection list). Search IGD: Execute the current query for IGD and put the found and selected objects in the Keyset (selection list). Search Server: Execute the current query on a remote ACEDB server and put the found and selected objects in the Keyset (selection list). Undo: Cancels the last command and redisplays the previous Keyset (selection list). ######################## In addition to the commands above, the Menu have the following options : ######################## Print Window: Same as Print Button: Print this window to a postscript file and send to printer (ACEDB_LPR). Refresh: Redraws the window. Clear Entries: Same as Clear Button: Clears all the user-entry boxes on the window. Query By Example: Same as the By Example Button. Call up the Query-by-example window. Query Builder: Same as the Builder Button. Call up the Query Builder window. Load From File: Same as Load Button: Loads the file Directory/FileName.qry if it exists. The ending .qry is added automatically Save To File: Same as Save Button: Saves the present set of commands into the file Directory/FileName.qry if you have write access to Directory. The ending .qry is added automatically Send: Same as Send Button: Not used widely yet. (For Otto Ritter) This command sends the query to a remote distributed database. Enable Autosave: Disable Autosave: When enabled (either by setenv ACEDB_AUTOSAVE or from menu on query window), this function will save the current series of query commands by appending the it to the end of a time-stamp labelled file in wquery/. These files can be later edited (using a simple text editor) and/or loaded. The backup save occurs whenever a Find (query search) is executed. Search Locally: Same as Search Locally Button: Execute the current query and put the found and selected objects in the Keyset (selection list). Search IGD: Same as Search IGD Button: Execute the current query for IGD and put the found and selected objects in the Keyset (selection list). Search Server: Same as Search Server Button: Execute the current query on a remote ACEDB server and put the found and selected objects in the Keyset (selection list). Undo Search: Same as Undo Button: Cancels the last command and redisplays the previous Keyset (selection list). ######################## In addition to the commands above, the Menu have the following options : ######################## Refresh: Redraws the window. Autosave: When enabled (either by setenv ACEDB_AUTOSAVE or from menu on query window), this function will save the current series of query commands by appending the it to the end of a time-stamp labelled file in wquery/. These files can be later edited (using a simple text editor) and/or loaded. The backup save occurs whenever a Find (query search) is executed. ######################## Other details : ######################## Direct Query Commands (allows the FULL query syntax) Please select Query_syntax or page down for more details. Edit these boxes the same as the User Entry Boxes (pick with mouse, use keyboard). Execute a query command by clicking (again) on the left mouse button or hitting the RETURN key. If you edit the last command line a new, blank box is created for the next input query command. Scope: If the query starts as: FIND my_class, the whole class my_class is searched; otherwise the query commands act on the active Keyset (selection list). To select another key set, pick it once. ################################################################### **Query_syntax of the commands A detailled description is presented in the manual doc/query_language_guide.tex There are 3 possibilities Find Class xxxxxx The command xxx is applied to all the keys of the (sub)Class Abbreviation: >?Class xxxxxx Follow Tag xxxx The command xxx is applied to all the keys following tag in the objects of the active key set. Abbreviation: > Tag xxxxxx xxxx The command xxx is applied directly to the active key set. A command is a logical expression evaluating to True or False. it is applied to a key which is discarded or retained in the resulting list. A composite query can be formed by chaining a series of queries separated by semicolons, in which case the active keyset obtained so far is passed into the next query. Recognised operators are, in order of increasing precedence: | OR ^ XOR & AND ! NOT # Jumps in constructed types. < <= > >= to compare numbers = to compare numbers or match the left hand side to a template, i.e a word with wild chars *, ?. COUNT Counts the number or entries to the right of its rhs IS xxx Checks if the name of the active object matches xxx CLASS xxx Checks if the active object belongs to (sub)class xxx Parentheses of all sorts "([" can be used freely, but must be matched. Words are matched to a tag or treated just as text. They must be put in "double quotes" if they include spaces or any operator &, |, ^, <, >, =, (, ), [, ], {, }. Wild chars can be used in words but then they are not at present matched to tags except in a redirection Numbers are parsed as floats. Examples (as given in $ACEDB/wquery/examples.qry) >?Chrom* will list all chromosomes >?Author s* | a* all authors whose name begins with s or a >?Au* s?s* OR b*s* all authors whose name matches s?s* or b*s* >Pap* Journal = N* OR Year > 1987 Checks the previous list : redirect to papers and lists all their papers published in N(ature) or after 1987 Year = 1988 Restricts to the papers of exactly 1987 >?Gen* myo* Clone All the cloned myosin genes Find Author IS "Sulston JE" ; >Paper ; >Author Finds all the coauthors of papers by Sulston. Subfields To find the value of subfields you must first locate yourself on the tag then move right from it using NEXT (move right) or HERE (move here) for multiple checks. For example the genes to the end of chromosome X are found with Find Gene gMap = X AND NEXT > 12 AND HERE < 19 ; Warning This is clearly hard to read, also it will be evaluated at execution left to right as it should only if the precedence of the operators allows it. Be careful. Subtypes To locate a tag in a subtytpe, you must indicate the path using the operator #, example: Find Gene Lab AND NEXT#freezer = 4 To find all the genes in your freezer number 4 COUNT To count entries, example, find prolific authors: Find Author COUNT Paper > 100 ################################################################### **Query_Builder The interface in this window is a little complex but it offers a great processing power. You can use the menu or act directly in the display, using either the user-friendly entry boxes (top) or direct query syntax (on bottom line(s)). If you pick the Black triangles, then you will get a BLOCKING, scrollable selector to choose from a long list of choices. Please don't forget to you must dismiss this window by either Cancel-ling with the button or menu, or by double-clicking to select a choice. The First Box on the First Line specifies what class you are seaching WITHIN. On the Second Line (and successive lines), the First Box is the Attribute that you are matching to. The Second Box is the Operator which may differ depending on the type of query you are performing (less than, equals, text). The Third Box is the Value you are matching to the Attribute. The Fourth (and last) Box is a conjunction to allow for more Conditions (as formed on the second line) to be specified. ######################## User Entry Box Details ######################## Class-Tag Box: (The box with the default "ANY CLASS" in top left.) Use this box to select the class you are searching within. This entry determines the list of attributes for the Attributes box. Pre-Class Box: (Usually Hidden, ignored, this box will appear in the top right area when the "Show More" option on the menu has been chosen.) Use this box for Secondary/indirect queries wherein you wish to find refer to this entry first, find a specific class within this entry's model, and search for objects within that second, specific class (which is specified by the Class-Tag Box). Attribute Box: (First box to the right of the text "where"). Use this box to list any attributes within a class' model which you wish to test for. On both the Selector and the Popup menu for the Attribute Box, you may see the choice "USE TAG CHOOSER" which will call up a model-display for the current class and you can double-click on a tag label to choose a tag within this context. Condition Box: (Second Box on line beginning with "where") This box presents a list of operators which will be applied to the attribute. >Some operators (exists, does not exist) do not take any arguments. In the top set of choices on the pop-up menu, "contains", "begins with", and "ends with" merely combine wildcards (such as "?" and "*") with the equality operator. >Equality and inequality can be tested for using the middle set of choices on the pop-up menu. >The bottom set of choices allows you to query on the number of instances of data (a REPEAT list) associated with the current Attribute in the data objects. Value Box: (Third box from right on "where" line.) Later, this may supply more hints as metadata becomes available. Currently, enter the arguments for the comparisons used in the Conditions box here. "?" (single character) and "*" (0 or more characters) are valid wildcards and quoted strings are accepted. Conjunction Box: (Last box, far right, on "where" line.) Use this box to form conjunctive query conditions, to use the "#" (and-submodel) function, and to demark the end of a query with the special word "END". ######################## The Buttons have the following options : ######################## (Most of the button and main menu commands are the same as the Query Commands window.) Quit: Quits this window with an option to save your current file of commands, provided you have given a file name. Help: Invokes this section of the help file. Print: Print this window to a postscript file and send to printer (ACEDB_LPR). Clear: Clears all the user-entry boxes on the window. New KeySet: Calls up a new, blank keyset window. By Example: Call up the Query-by-example window. Command Edit: Call up the Query Commands window. Search Locally: Execute the current query and put the found and selected objects in the Keyset (selection list). Undo: Cancels the last command and redisplays the previous Keyset (selection list). ######################## In addition to the commands above, the Menu have the following options : ######################## Print Window: Same as Print Button: Print this window to a postscript file and send to printer (ACEDB_LPR). Refresh: Redraws the window. Clear Entries: Same as Clear Button: Clears all the user-entry boxes on the window. Show More: Show Less: For more advanced users, this option will display (hide in case of Show Less) a box allowing the user to choose where to begin a query. ALL DATA is default. Otherwise, a query can begin from a class and search it's subclasses. A subclass of a class is a particular attribute (tag) within the class model and is named the same as a corresponding, separate class. Query By Example: Same as By Example Button. Call up the Query-by-example window. Query Command Edit: Same as Command Edit Button. Call up the Query Commands window. Search Locally: Same as Search Locally Button. Execute the current query and put the found and selected objects in the Keyset (selection list). Undo Search: Same as Undo Button: Cancels the last command and redisplays the previous Keyset (selection list). ######################## Other details : ######################## Query Builder (User Entry Boxes) : You activate an entry box by picking it (click with the left mouse button). It turns yellow (dark grey on monochrome) and all keyboard-input will then enter into that box. Use the right mouse button to bring up pop-up menus containing appropriate choices for each user-entry box. Not all functionality of the query language is implemented in the query builder. By some of these boxes, there is a triangle that can be clicked on with the mouse. This will activate a selector menu with a scroll bar in case the popup menu does not fit on the screen. "Cancel" must be pressed (button) or chosen (popup menu on selector window) or a selection must be made (double-click on an entry) to dismiss. Scope: The query commands modify the active Keyset (selection list). To select another key set, pick it once or use the New KeySet option on the menu. Query Commands Display: If the Query Commands window is open, the syntax formed by the Query Builder will be shown on a command edit line there. Please select Query_syntax or page down for more details. ################################################################### **Query_By_Example Based upon a fill-in-the-blank and toggle-button style of entry, this window allows the user to fill in values in a class model-display. These values are then used in a conjunctive query command to retrieve data objects from the database. This window can be used in conjunction with or independently of the Query Window. (see Query); >> -*- IMPORTANT: Note that some attribute-tags are used in a boolean >> *+* exists/does_not_exist fashion. See Boolean Attributes below. >> -*- Also, to execute a query formed in this window, use the FIND button. N.B. If you Read Models and update the models, you may have to restart the ACEDB program for the correct QBE display to appear. ######################## The Buttons have the following options : ######################## Quit: Exits the window. Help: Invokes this section of the help file. Clear: Clears the entry boxes and redraws the window from scratch. New KeySet: Calls up a new, blank keyset window. Command Edit: Call up the Query Commands window. Search Locally: Execute the current query and put the found and selected objects in the Key Set. Undo: Cancels the last command and redisplays the previous Keyset (selection list). >From Selector/ Change Query Search Box: Actually a menu (activate by right mouse button), this allows the user to use the current keyset as the base for a query or to use the current class shown. Simple clicking of the left mouse button will "step" through the menu selections. Class Selector/ Change Class Status Box: Actually a menu (activate by right mouse button), this allows the model being currently shown to be changed to any class in the database. Simple clicking of the left mouse button will "step" through the menu selections. ######################## In addition the the above functions, the Menu has the following options: ######################## Print: Print this window to a postscript file and send to printer (ACEDB_LPR). Refresh: Redraws the window. Query Builder: Same as the Builder Button. Call up the Query Builder window. Query Command Edit: Same as Command Edit Button. Call up the Query Commands window. AND, OR : The various tags and fields are connected via the conjunctions AND (&) and OR (|) as selected on the menu. Use the Query Builder window to view the composed query command. Show Full Description: Calls up the metadata associated with the last picked (left mouse button) label or entry-box on the display. Show Long Description: Calls up the ?LongText metadata associated with the last picked (left mouse button) label or entry-box on the display. Search Locally: Same as Search Locally Button. Execute the current query and put the found and selected objects in the Keyset (selection list). Undo Search: Same as Undo Button: Cancels the last command and redisplays the previous Keyset (selection list). ######################## Other details : ######################## User Entry Boxes: You activate an entry box by picking it (click with the left mouse button). It turns yellow (dark grey on monochrome) and all keyboard-input will then enter into that box. On a carriage-return (CR), the entry is processed for correctness and, if the Query window is up, will output a formed query to the current query command line. Any subsequent call to the Find button will re-process the every entry's current contents, form the query on the Query window (if appropriate), and execute the query. ITEM NAME: This is a special box at the top which can be activated to query using the names of items within the current class. Valued Attributes: (also called attribute, field, tag, subclass) All valid attributes will have an Entry Box to the right of it's name. Simply pick and edit a box for it to be folded into the current query command. Sub-conditions, such as "< 100.1", "> fred", and "!= gene21" are allowed in these lines. For the numeric entries, the user will receive a warning that the syntax is not numeric, which can be ignored at the user's choice. All Attributes: If you wish to deactivate or activate only the tag, the attribute labels can be toggled on or off regardless of whether or not a corresponding attribute field is empty or filled. Scope: The query commands will modify the active Keyset (selection list). To select another key set, pick it once or use the New KeySet command. Query Commands Display: If the Query Commands window is open, the syntax formed by the Query-By-Example window will be shown on a command edit line there. Please select Query or page up for more details. ################################################################### **Table_Maker This facility is related to the Query system discribed above. It allows the construction of tables, or tuples, of object names and field values and the construction of multiple-maps (see below). This system uses 3 windows, the definition window explained here, which allows you to define your table, the data window which reuses the same space and is explained in the next section, and the multimap window which is created by pressing the map button in the data window. The interface in the definition window tries to be more user friendly than the interface in Query. Once constructed, the definition of a table is stored in the directory ./wquery as **.def. It is however unwise to edit the def file by hand and we recommand that you edit it via the interface. MAJOR BUG: As of 1-9, you can only access the first line and first column to the right of a tag. For example, if you try to list all exons in a sequence, you correctly obtain the start of each exons, but it is then wrongly followed each time by the end of the Fisrt exon. ######################## The menu has the following options : ######################## Quit: Quits this window with an option to save your current file of commands, provided you have given a file name. Help: Invokes this section of the help file. Print: Prints out this window as is. Save: Saves the present set of definitions into the file Directory/FileName.qry if you have write access to Directory. The ending .def is added automatically Load: Loads the file Directory/FileName.def if it exists. The ending .def is added automatically Create definition: Creates space for a new definition. See below. Suppress definition: Suppresses the active definition. You activate a definition by picking one of its boxes, for example the hidden/visible buttton. Show All Data: If you have just changed the definitions, initiates a search of the whole database according to your definitions and display the results. Else re displays the same data, even if they were contructed from the active KeySet. In particular, modifying the width of a column or its visible/hidden status does not initiate a new search. Show Active KeySet: Initiates a search of the objects enumerated in the Active-KeySet according to your definitions and displays the results. ################################## A Definition consists of: Its number, which is used in the "Constructed from" field of the other definitions. A widht box, which you can edit after picking it with the left mouse button. It indicates the widht of the column of data when displayed. Press return to fix, the value. A visible/hidden button. You can rotate it with the left mouse button by picking or directly with the rigth mouse button and a pull-down menu. If a definition is hidden, the corresponding data will not show in the data-display. This will reduce the number of columns of the data display, but most probably, also the number of lines. For example, if you show a paper in column 1, and its authors in collone 2, you will get as many lines as authors, by hiding author, you keep only one line. An optional/mandatory button. You can rotate it with the left mouse button by picking or directly with the rigth mouse button and a pull-down menu. If a definition is mandatory, only the lines satisfying it will be kept. This restriction applies even if the corresponding definition is hidden. The Class field. In column 1, Class is a pull-down menu which can be activated with the right mouse button. It lists all the visible classes, but you should only select a B-class. When you then press the show all data button, only the corresponding class wil be explored. The Constructed from field. Tells the system where-from it should recover its data. The Tag button. By pressing the tag button, the model of the class of the definition you are "constructing from" is displayed. Double pick an entry there. You active definiton will be updated accordindly. There are 3 possibilities: Tag, Object,Value. For example, the Gene Class model has a line: gMap ?Chromosome Float Float Picking gMap, the column will be Boolean, with entry TRUE or FALSE, depending if gMap is present or not in the corresponding gene. Picking ?Chromosome, the column will be Class Chromosome, and you will be able to use it as a from from a follow up definition. Picking the first or second Float, the column will display the corresponding number, in this case a position on the genetic map and may use this column of number to draw a multiple map. You may also edit the tag field manually, following the Query-syntax explained in the preceeding page, but this will not edit the Class field of the definition which must be set either by editing the .def file manually or by using first the tag button and choosing the same sort of field. The condition field is applied at last to the selected object. In fact the query system is applied twice in every definition, once using the tag field, to select the piece of data you want, a second time, using the condition field, applied to the picked object. The best is to srudy and edit the exampleds provided and/or complain to the authors. BUG: At present, you cannot restrict a number to a given range using the condition field, sorry, this should be fixed later. ################################################################### **Table_Maker_Data Quit: Quits this window with an option to save your current file of commands, provided you have given a file name. Help: Invokes this section of the help file. Print: Prints out this window as is. Switch: First touch an element in some column, then press Switch, this will exchange the active column with the one immediatly to its right. At the same time, the line are reordered so that they always reamin in alphanumerical order left to right. By Putting the genes left of their position, you get them in alphbetic order, by putting first the chromosome, then the position, then the gene, you get them in genetic map order. Export KeySet: Exports the active column, if it contains keys. Define Table: Returns to the Table_Maker definition window. Map: Construct a multiple map based on the visible numerical columns. See next help-page. Ascii Dump: Dump the table in Ascii format. ################################################################### **Multi_Map This facility is invoked by the Map button of the table_Maker. Then interface is modelled on the genetic map display. Each numerical column of the table corresponds to a map. Each entry is shown as a yellow square which you may pick. Squares corresponding to a single line of the table are linked together, ending on the name of the object in column 1 of the definition of the table. Note that by switching the columns in the table, yous witch the maps but you cannot change the name shown. This is because only the name in column 1 is garanteed to be unique. When you pick a name or a square, the corresponding line in the Table is lighted. Quit-Help-Print: as usual. Zoom all/Zoom active: Using the wwhole and zoom in/out buttons you zoom either the active map or all of them at the same time. Recenter: You can recenter the active map with the mid mouse button. Zoom and recenter: With the mid mouse button in the left part of the graph, you can zoom and recenter at the same time by dragging in x-y. This action applies to the active map only. With these functionality it is easy to realign a given region of the mutimap. A good exaple is given in g2pmap which you can load from the table maker definition window. ################################################################### **Histogram An embryonic graphical tool. Prototype: void plotHisto(char *title, Array a) ; Plots the histogram of the array of integers a. Print: Outputs the result to the Post Script file ./PS/histo#.PS The histogram itself is plotted in blue. In the top right corner: total indicates the cumulated sum, i.e. the integral of y(x), max y(xm) = ymax indicates the coordinates (xm,ymax) of the maximum. max x is the maximal x value. In the top left corner, the pair of number indicates the coordinates of the center of the black reticule. Picking anywhere with the left mouse button, you can move the reticule and get its new coordinates. Statistics: Primitive: just gives the average and the variance of the plot. ################################################################### **Plot_Curve Another embryonic graphical tool. Prototype: void plotCurve(char *title, Array a) ; Plots the curve described in A as an Array of pairs of float: x1, y1, x2, y2 .... Print: Outputs the result to the Post Script file ./PS/histo#.PS The histogram itself is plotted in blue. ################################################################### **Bibliography Displays the bibliography related to a KeySet. This tool is called from another display window by invoking there the menu entry Biblio. Print: Outputs the result to the Post Script file ./PS/biblio#.PS ################################################################### **Tree This represent a typical Text object (class B) Buttons ******* Quit, destroys this window. Tables... : this button is only present if a table_maker command file has been registered with the class of the urrent object in the file wspec/table.menu.wrm. If present, the button contains a submenu with the list of these tables which are selected with the right mouse button. The main menu has the following entries: Help, displays this help page. Print, prepares a Post Script file pmapxxx.PS in ./PS You can then print it on your local laser printer. Update: Lets you edit the object, only if you have write access. Please select Update or page down for more details. Biblio: Pops a window with all the papers related to the object The paper themselves which are part of the list, those written by the authors of the list, those quoting the genes of the list, etc. The Biblio window can then be printed. Tree: Displays the active box a s tree if possible, rather than graphically as may happen when you double click a box. Image display and other system calls: There is a special Tag: Pick_me_to_call present in particular in class Image. Picking twice this tag will call an external program defined just after the File tag, the second parameter beeing a file name suppose to exist in the subdirectory externalFiles. For example, we could have Pick_me_to_call iconedit myIcon Resulting in the call system(cd externalFiles ; iconedit myIcon) ; ################################################################### **Update Lets you alter and modify any text object. Double click on anything to add/change. Objects in blue are part of the model, i.e. new things that you could add. If you double click on part of the exisiting object you will be able to edit it, if on the model you will be asked to add a new entry. If the entry is for an object name then you have a number of options. You can double click on the object name in another window if you have it displayed. Alternatively you can type in the name of the object. If you type in a partial name and hit the TAB key then a list of possible completions will be given in the Main Selection Window, and your entry in the update window will be automatically completed up to the first ambiguous letter. In particular if there is a unique existing completion then it will be expanded in full. Quit, destroys this window. Help, displays this help page. Save, saves the updated object to the database. From then on, the new values will be used in the current session. The changes will become permanent only if you also Save the session from the main ACEDB menu. Add comment, let you add a comment anywhere in a an object, irrespectively of the model. You can even attach your comment to the third number of a list of five. The comment will be lost if the entry it is attached to is deleted. Delete: Deletes the selected entry (tag, data or object - pick it first) and anything to the right of it. You can delete whole subtrees. Cancel: Cancel the current command (Add, Edit, or Add Comment). Edit: lets you edit an exisiting entry (equivalent to just double clicking on it). ################################################################### **Dump Dumps the whole data base into an ace file. The dump file can be edited by hand, parsed back in an empty system (provided you split out the copy of the tags and classes files) or use with diff to compare 2 sessions. At the same time, Dump checks the integrity of the whole database, verifies the existence of all the XREF's. Dump dumps all the Visible A and B(not X) classes this information is sufficient for a complete reconstruction. ################################################################### **Physical-map This display represent the alignement of clones into contigs Next help page explains the clone types Picking in the Yellow bar (when present) moves you to the sequence. Picking in the lower Green bar moves you to the genetic map by local linear interpolation btween the nearest localised clones. Quit, destroys this window. Help, displays this help page. Print, prepares a Post Script file pmapxxx.PS in ./PS You can then print it on your local laser printer. Preserve, insure that the next pmap will be displayed in a different window, otherwise the present one will be reused. Redraw, useful from time to time if the window gets clogged accidentally after moving the window or following arrows. Recalculate, recomputes the display from the map data. Otherwise, the same display is shown again and again. We could make the recalculation automatic after any update of the clone tress but it would slow the program if you alter some data which do not actually influence the drawing. Show All Remarks, there are three categories of comments: General_, PCR_ and Y_. Typically, PCR_ and Y_ comments were used by John and Alan to help build the map (as are many General_ ones) and are not very useful to the rest of us. This switch is a toggle - turning on and off showing the extra comments. To Genetic Map: Moved to the real or estimated genetic position of the selected item. Apart from the menu options, you can pick any clone and obtain it in text form, or pick the comments and the genes that may appear under the map. Using the arrow keys, you will move from one clone, comment or gene to the next. The mid button recenter the display, slowly in the upper part of the window, faster in the lower part where a back bone of the physical map is shown. NB Page down to get a list of clone types ################################################################### **Clone-types Clone types in the physical map of Caenorhabditis elegans. Most clones are defined by their initial letter(s), according to the table below. The principal exceptions are:- (1) Clones given laboratory designations (2 letters followed by #) (2) MIT clones, which have 1, 2 or 3 identical letters, followed by any letter from A to H, followed by a number from 1 to 12. Vector is pHC79. Clone Vector: name: A Lambda 2001 Sau3AI partial ZL Lambda 2001 Sau3AI partial probed YSL Lambda 2001 YAC subclones, Sau3AI partial B pJB8 serial Sau3AI partial C pJB8 gridded in microtitre plates Sau3AI partial D pJB8 gridded on filters Sau3AI partial E pJB8 EcoK minus Sau3AI partial R pJB8 RI partial M pJB8 MboI partial ZC pJB8 probed K LoristB Sau3AI partial T Lorist2 Sau3AI partial W Lorist4 NotI plus Sau3AI partial F Lorist6 Sau3AI partial ZK 15- 56 Lorist6 Sau3AI partial probed 57-130 Lorist2 " " " 131-164 Lorist6 " " " 165-177 Lorist2 " " " 178-192 Lorist6 " " " 193-344 Lorist2 " " " 345-354 Lorist6 " " " 355-514 Lorist2 " " " 515-552 Lorist6 " " " 553-596 Lorist2 " " " 597-616 Lorist? " " " 617-626 Lorist2 " " " 627-692 Lorist6 " " " 693-756 Lorist2 " " " 757 onwards Lorist6 " " " Y pYAC4 RI partial ################################################################### **Contig-editor Picking on displayed entities follows the paradigms of the physical map. In addition there is a control bar at the top of the graph, containing menu- buttons, and a cue. The editor has four menus, which can be selected by picking on the menu buttons. The control bar has a yellow window displaying the latest-visited position of the scrolling cursor (middle mouse button) in band coordinates. Cues and information messages are displayed on the right of the control bar. The map has a scale calibrated in band units. SETTING AND USING MARKS A mark is a labelled position on the contig. It is represented by a vertical line through the map, labelled with a band position. The current mark is highlit (yellow). Most editing operations are carried out relative to a mark. Marks can be set anywhere in the contig, and used to snap to a given part of the contig, which may be off-screen. The simplest way of setting a mark is to line up the scrolling cursor with a feature on the map, and select "Set Mark At Cursor Position". MARKS MENU - Set Mark At Cursor Position: set a mark at the current cursor position - Mark Centre: set a mark at the current centre of graph - Mark Centre Of Cosmid: set a mark at the centre of the current cosmid - Set Mark: set a mark at a specified band coordinate - Zero Scale To Mark: recalibrate the scale with current mark=0 - this does not change the model - Set Scale At Mark: recalibrate the scale with current mark= specified band coordinate - this does not change the model - Reset Scale: restore original calibration of the scale - Snap To Mark: display graph centred on current mark - Snap To Previous Mark: display graph centred on previous mark: this allows toggling repeatedly between the latest two marks set - Visit Mark: display graph centred on each mark set, in turn, in reverse order - Delete Mark: delete current mark (this will occur even if it is off-screen) - Delete All Marks: you guessed it UTILITIES - Overview Physical Map: peek at the default physical map display, preserving the state of the editor - useful for fast scrolling using the physical map's mini-contig - Finished Edit: finish editing session, and revert to the default physical map - Quit: quit this physical map - like Quit on the default map - Help: what you are reading - Print: PostScript dump of the edit panel - Preserve: as elsewhere - Redraw: as elsewhere - Remarks: vary the density of remarks displayed in the edit panel: this is a switch with three states - Recalculate: as elsewhere - Unhighlight, Revert: clean the edit panel - remove all highlighting, editing marks, etc and restore the default level of remarks EDITING CLONES - Left End Of Clone To Mark: move the currently-selected clone so that its left end abuts the current mark - Right End Of Clone To Mark: move the currently-selected clone so that its right end abuts the current mark - Extend Left End Of Clone To Mark: extend the currently-selected clone so that its left end abuts the current mark - Extend Right End Of Clone To Mark: extend the currently-selected clone so that its right end abuts the current mark - Show Buried Clones Of Clone: show buried clones of currently-selected clone - they are not automatically positioned at present - Show All Buried Clones: show all buried clones of the contig - they are not automatically positioned at present - Attach Clone: introduce a YAC or cosmid into the contig - Detach Clone: detach the currently-selected YAC or cosmid from the contig CONTIG-WIDE OPERATIONS - Open Contig: The contig is cut at the current mark, and one side positioned relative to the other by dragging it left or right with the left mouse button down, to compress or extend the contig at the mark. A crosshair marks the current cursor position. The current position of the moving side of the cut is displayed in the cue, and the current position of the cross-hair cursor is displayed in the yellow position box in the control bar. When the contig is recalculated, a new mark is placed automatically at the final position of the moving side of the cut, and the position of all affected marks is updated. F4 has the function of an UNDO key for this operation: you can interrupt and back off this operation. AUTOPOSITIONING Operates on two keysets: one specifying the domain of interest for matching, the other the new clones. Generates a report of results which has operations defined on it for surveying and editing positioned clones. After running the autoposition function, the internal cache representing the domain set, and the data of the results of the autoposition function can be saved in separate files for future use. The default domain is the entire database of clones - this does not have to be specified explicitly; and its internal representation can be saved for future use. Generating the internal representation of the domain is a slow operation for large keysets. The results are displayed on a pad with sensitive areas. This allows picking clones of interest. A pick on a matched clone in the context of the pad causes the clone of interest (the "subject") to be positioned against the match on its contig. The result of this operation can be Edited, Accepted, Rejected, or Bury-ed beneath its match. Use of accelerators: the following have been defined on the pad, and on the edit panel when autopositioning is in progress. UP, DOWN arrow keys - previous, next match for the current subject LEFT, RIGHT arrow keys - skip to results for previous, next subject 'a' - accept this match (adds subject to the contig) 'r' - reject this match 'e' - add the subject to the contig as displayed, for manual edit 'b' - bury the clone under its match Fingerprints can be displayed on a separate window, which acts as a scrollable log file. AUTOPOSITIONING - AUTO MENU ON EDIT PANEL - Autoposition Clones from Keyset: use current keyset - Set Autoposition Domain: use current keyset to define domain of Autoposition operation - Load Domain: load internal representation of domain from named file - Use Whole Database: implicit argument - Save Domain: in a named file - Load Results: load data of previous Autoposition from named file A results file cannot be loaded without loading an appropriate domain file. - Save Results: in a named file - Fingerprint: show fingerprint of the currently-selected clone AUTOPOSITIONING - REPORT PAD MENU - Quit - Help - Print - Preserve - Save Results - Save Domain - Tree Switches - - Set to Edit: the default behaviour of the accelerator keys is to advance to the next match (or next subject's first match) and position against that: when this switch is set, the latest match is displayed on the edit panel after using the accelerators, instead - Show Fingerprints: when this switch is set, clone fingerprints are displayed automatically in the Fingerprint window whenever a clone on the report is selected, or the accelerators are used Edit operations - - Accept - Reject - Edit - Bury Clone - Fingerprint: show fingerprint of the currently-selected clone FINGERPRINT WINDOW MENU - Quit - Help - Print as default. ################################################################### **Genetic-map This display represent the genetic map. You can pick most things. The contigs are displayed past their last gene -- in many cases they extend much further, but we don't really know how far in genetic units so take our estimate estimate with caution. If you double click on the contig it interpolates to the physical map using the nearest two genes for which there is genetic map data. Sometimes if the relative order is wrong this can be confusing. All this will improve in the future. MENU: Quit, destroys this window. Help, displays this help page. Print, prepares a Post Script file pmapxxx.PS in ./PS You can then print it on your local laser printer. Preserve, ensure that the next gmap will be displayed in a different window, otherwise the present one will be reused. Recalculate, recomputes the display from the map data. Otherwise, the same display is shown again and again. We could make the recalculation automatic after any update of the clone tress but it would slow the program if you alter some data which do not actually influence the drawing. Highlight Selected Objects/Show Selected Objects/Show All Objects Highlight or restrict to only those objects belonging to the map and the selected keyset (normally the list in the Main Selection Window, or one made by the Query facility). All reverts to the complete unhighlighted map, and removes any highlighting from the GMap Data button option. Load/Save Private Map After editing a map you can save and retrieve it later. The saved map does not appear in the standard chromosome list. BUTTONS: Whole Chromosome, Zoom In/Out affect the amount of the map being displayed. They are equivalent to the continuous centering and zooming that you get by picking with the middle button in the left column of the map and dragging up-down to recenter, left-right to zoom. GMap Data: Shows CGC map data in graphical form. You can click on the 2point and 3point data entries to see the actual data. Highlight/Some/All: Equivalent of the menu entries to highlight or show selected or all objects. Drag Gene: Pick a gene or a def-dup, press this button, then drag the gene with the mid mouse button. Useful to edit the map. You can then save your private version. COLOR CODE when using the "GMap Data" button. Red : The active object. Yellow: Contact to the physical map. Yellow genes are cloned. The little yellow boxes are direct hooks to these clones. The long yellow bar is the contig. Picking it moves you to the corresponding place in the contig. Grey : Background to the name of the colored rearrangement. Green : Those genes covered by the red rearrangement. Those rearrangements covering a red gene. The gene mapped 2_points relative to the red gene. Blue : Those genes not covered by the red rearrangement. Those rearrangements not covering a red gene. The gene mapped 3_points relative to the red gene. Magenta : Objects explicitly highlighted with the Highlight option. The All button removes green, blue and magenta colours. The ZOOM buttons act on the whole map around the center represented by the little green box. DRAGGING. You can recenter the display by pressing with the centre mouse button and dragging, or by picking with the left mouse button and dragging either - the small black box sitting on the scale. - or the long green box at the left of the picture. ################################################################### **Chromosome-map This display represent the the Chromosome in physical units. The little squares are clones. You must import them from a keyset using the menu. You can import anything whose position is known in physical units such as clones, cDna, clone genes etc. MENU: Quit, destroys this window. Help, displays this help page. Print, prepares a Post Script file pmapxxx.PS in ./PS You can then print it on your local laser printer. Preserve, insure that the next gmap will be displayed in a different window, otherwise the present one will be reused. ################################################################### **Feature-map Click page-down for more information. This display represents the the sequence. You can pick most things. GENEFINDER Much of the functionality of Phil Green's genefinder package is built into ACEDB. A reference is given when you first use the package. To access genefinder functions, use the right mouse button on the indicated box to get at the submenu. You must get "Genefinder features" first. Then "Autofind Gene" will act in the current active zone. It will attempt to find the best predicted gene including all features currently selected (indicated in LIGHTGREEN). If you have write access it will create a working gene model, called "Temp_gene". Selected features can be hand-edited by using the submenu attached to each feature. "Fix temp_gene" allows you to make temp_gene into a permanently stored gene prediction. "Gene->selected" allows you to set the selected features from a previously determined gene. "Selected->temp_gene" lets you convert the currently selected features into a gene structure. One common cause of problems is that some features are selected somewhere else in the sequence (perhaps the other strand!) -- use the "Clear" button to reset everything. Genefinder uses tables of codons frequencies etc which are part of the acedb distribution in the wgf subdirectory. The environment variable GF_TABLES will overide the $ACEDB/wgf default and let you use your own tables. DISPLAY CONTROL BUTTON This gives access to a menu of display options. All the options can be toggled by picking on them. e.g. select "DNA Sequence" to see the DNA. Note that, to see the DNA, you should zoom in quite a lot. Otherwise the bits of sequence ends with ... on each line. MENU: Quit, destroys this window. Help, displays this help page. Print Screen / Print whole Map Prepares a Post Script file pmapxxx.PS in ./PS You can then print it on your local laser printer. Preserve, insure that the next gmap will be displayed in a different window, otherwise the present one will be reused. Clear DNA, Uncolors the DNA Hide Header Hides the buttons etc, useful before printing. The poo up menu remains available to toggle back. Color exons Shows the exons on the DNA sequence if present. Export translation Export the translation of the active gene as an Ascii file in Fasta format Export translations Export the translation of all teh genes of the active map in a singel file in Fasta format Export Sequence Export the active DNA zone in fasta format. Statistics Prints on the console some statistics on genes, exons etc. Analysis window, opens a new window called dna-analysis with its own help entry (the next page). TOP LINE The last sequence you touched is the Selected fMap, this shows in red in the top left corner. This is the sequence used by dna analysis and gels. You can have several sequence on the screen if you use the Preserve option in the menu. ZOOMING The Zooming works as in the genetic map. It is controlled by the 3 buttons, whole(when you are lost!), zoom in, zoom out, and the mid mouse button: to recentre slowly if the mouse is rigth of the scale bar, or recenter fast and zoom continuously by dragging the mid button starting left of the scale bar. ACTIVE-ZONE and ORIGIN You can reset the origin by picking the origin value box, typing a number and RETURN. Alternatively, pick the Origin button then a gene. The active zone, indicated in the same coordinate system limits the scope of the Anaylsis window, Genefinder, Fasta Dumps etc. It then shows as blue Shutter lon the left side of the yellow bar. CLEAR Clears the colourings, genefinder selections etc. REVERSE-COMPLEMENT Pick it with the left button to reverse complement the sequence. But if you press the right mouse button, you get a sub-menu that lets you independently complement or reverse the sequence. This may be useful to compare the features of both strands. On the top right corner of the window, the staus REVERSED or COMPLEMENT is recalled. Introns-exons are shown as rectangular boxes (the exons) connected by springs, the introns. The one on the right go downwards, the one on the left of the scale go upwards, i.e. they belong to the other strand. They correspond to the negative reading frames of the analysis menu. Picking the subsequences move you to their text value. Picking the clone box which may occur at the top will move you to the physical map. In the case of cDna you will get a text hybridize to Yacs..., picking one of these yacs will put you on the physical map. ################################################################### **DNA_analysis Click page down for the genetic code. This window is a command tool. It acts: either on the active sequence window or, if you press the "Search active Keyset" button, on all the sequences listed in the currently active keyset. That button is a toggle and turns RED when activated. Searches on the dna result in coloration of the sequence, which shows on the bases and amino acids, if shown, and on the yellow strip. Quit, destroys this window. Help, displays this help page. Print, prepares a Post Script file xxx.PS in ./PS You can then print it on your local laser printer. Finger print: Restricts with the enzymes used for the C.e. physical map hindIII and sau3aI. You get prompted for the name of a file where the result of the search may be exported. The sites are shown in 2 colors in the feature window. Restriction Key_Set Will import a list of restriction enzymes that can then be searched for in the active sequence or KeySet of sequences. Restrict Site Text-editor: Searches for AA motifs or Bases restriction sites. You can give the sequence you search for or the name of a set of known restriction enzymes, (list the class Restrict to see them). The sites are shown in the sequnce window, and recorded at the end of the Dnacpt window. The use of ambiguous letters such as R is allowed To activate the search type return.. Try also the Show Gel Button. Dump Sequence: If UseKeySet is set, dumps in fasta format all sequences of the active keyset (or selection list). Else, dumps in fasta format the active region of the active sequence window, e.g. you can fasta dumps bases 3800 to 7000 of a given sequence. poly R/ poly Y: looks for 12 or more contiguous AG or TC segments, and prints out the result of the search. This is equivalent to search for a restriction of 12 R or 12 Y (r is a-g, y: t-c), but the print out is more precise. Splice Concensus: Gives the 5' and 3' splice concensus sequences around the introns exons boundaries in the sequences of the active keyset. The result is shown in the Dnacpt window itself. Resize the window to see it. Codon Usage: Gives the codon usage in the sequences of the active keyset. The result is shown in a new window. Note that the genetic code is recalled in the next page of this help. Lengths: Gives the histogram of the lengths of the individual sequences in the active KeySet. Show Gel: Pops a Gel Tool with its own help page. Clear: Clears the Dnacpt window, useful before using Splice concensus or restrict buttons. ################################################################### **DNA_and_amino_acids_nomenclature DNA G Guanine A Adenine T Thymine C Cytosine R Purine A,G Y Pyramidine T,C M Amino A,C K Ketone G,T S Strong interaction C,G W Weak interaction A,T H not-G A,C,T B not-A G,C,T V not-T A,C,G D not-C A,G,T N any G,A,T,C AMINO ACIDS Here is a list of the standard one-letter amino acid codes and their three-letter equivalents. The synonymous codons and their depiction in the IUB codes are shown. You should recognize that the codons following semicolons (;) are not sufficiently specific to define a single amino acid even though they represent the best possible back translation into the IUB codes! All of the relationships in this list can be redefined by the user in a local data file described below. Symbol 3-letter Meaning Codons Depiction A Ala Alanine GCT,GCC,GCA,GCG !GCN B Asp,Asn Aspartic, Asparagine GAT,GAC,AAT,AAC !RAY C Cys Cysteine TGT,TGC !TGY D Asp Aspartic GAT,GAC !GAY E Glu Glutamic GAA,GAG !GAR F Phe Phenylalanine TTT,TTC !TTY G Gly Glycine GGT,GGC,GGA,GGG !GGN H His Histidine CAT,CAC !CAY I Ile Isoleucine ATT,ATC,ATA !ATH K Lys Lysine AAA,AAG !AAR L Leu Leucine TTG,TTA,CTT,CTC,CTA,CTG !TTR,CTN,YTR;YTN M Met Methionine ATG !ATG N Asn Asparagine AAT,AAC !AAY P Pro Proline CCT,CCC,CCA,CCG !CCX Q Gln Glutamine CAA,CAG !CAR R Arg Arginine CGT,CGC,CGA,CGG,AGA,AGG !CGX,AGR,MGR;MGN S Ser Serine TCT,TCC,TCA,TCG,AGT,AGC !TCX,AGY;WSN T Thr Threonine ACT,ACC,ACA,ACG !ACN V Val Valine GTT,GTC,GTA,GTG !GTN W Trp Tryptophan TGG !TGG X Xxx Unknown !NNN Y Tyr Tyrosine TAT, TAC !TAY Z Glu,Gln Glutamic, Glutamine GAA,GAG,CAA,CAG !SAR * End Terminator TAA, TAG, TGA !TAR,TRA;TRR ################################################################### **Useful_sequences Trans splices leaders: SL1 = "ggtttaattacccaagtttgag" ; SL2 = "ggttttaacccagttactcaag" ; ################################################################### **Codon_usage This windows gives the codon usage for the sequences of the active KeySet ################################################################### **Agarose-Gels This display is intended to help you interpret a restriction gel that you could run on a mutant by showing the expected wild type gel. You can type in the entry boxes the name of one or several restriction enzymes separated the semi columns, or little sequences. Ambiguous bases like n, w, s etc are reconised (see help on DNA_nomenclature). The lane will correspond to the active DNA window. If you click a band, you light the corresponding part of the sequence and the overlapping bands in the other lanes of the same gel. The distance is a log funtion of the lenght of the dna-segment as given in: figure 6.1 page 6.5 ; Molecular cloning, a laboratory manual second ed. Sambrook, Fritsch, Maniatis ColdSping Harbor lab. press, 1989 distance = 3.5 * ( 4 - log10(length) ) ; The MENU has the 3 standard entries: Quit, destroys this window. Help, displays this help page. Print, prepares a Post Script file xxx.PS in ./PS You can then print it on your local laser printer. ZOOMING The Zooming works as in the genetic map. It is controlled by the 3 buttons, whole(when you are lost!), zoom in, zoom out, and the mid mouse button: to recentre slowly if the mouse is rigth of the scale bar, or recenter fast and zoom continuously by dragging the mid button starting left of the scale bar. OTHER BUTTONS The coordinate button is a toggle that prints its length directly above each band, in base pairs. We hope to introduce soon other commands to add or remove a site at a given place PICKING A BAND If you click once on a band, its exact length is shown in the left top yellow 'Position' box. If you click again, you will color the corresponding band on the sequence display. If the sequence is no longer the one used to produce the gel band, the program is suppose to realise it, but we have not tested all possible cases. At the same time, you will color the matching bands in the other lanes. To restore the normal colors, select the same digestion box and type Enter. MORE ON DIGESTIONS To perform a digestion, select a sequence window, select the origin and length of the bit of sequence you wish to digest. Then pick one of the text boxes top right in the Gel display. It turns yellow. Type in your restriction enzymes separated by semi columns (names or little sequences). Then type return. A typo will display the help page on the genetic code. As many lanes as you wish can be displayed. The window resizes properly. Different lanes may correspond to different sequences, but then we are not to sure that the recoloring trick is bug free. So you may have to clear the display from time to time. ################################################################### **Clone-Grid This display is designed to display hybridisation data from the YAC polytene filters (and other gridded filters), and provide a tool for people to go between such data and the map, even when they don't have write access to the database. You see a set of squares layed out in the same pattern as the clones on the filter. To help orient you, the rectangle at left containing "LABEL" corresponds to where the numerical label is written on the filter. The current active box (after you have clicked once in a box) has a cross in it and is outlined in red. The name of the corresponding YAC is shown in the "Gridded Clone" text entry box at the top. If you click on this to make it yellow, and type in the name of a YAC on the grid, that will be indicated with a cross/outlined in red. You can also click on the "Gridded Clone" button, in which case you can pick on YAC's elsewhere, such as in a physical map window. This is useful for finding where neighbouring YAC's on the map are on the grid. There are two modes: Edit Mode and Map Mode. The mode with the coloured box is current. You can switch by picking the other box. Map Mode: when you click twice on a box you go to the physical map. If it is an empty box, then you will go to the corresponding YAC. If it is filled then it, and all the other filled boxes representing YACs that overlap, are highlighted in red, and you go to the average position on the map that they define. i.e. if a number of boxes are filled (positive) then map mode splits them into groups, each of which corresponds to one potential map locus. The grouping is done by taking all YAC's within some range into a cluster. This range is 20 by default. It can be changed with the menu entry "Set Cluster Range". Edit mode: this lets you define a pattern. Click with the left mouse. One click in a box gives a dark blue fill, a second makes it pale blue (signifying a weak signal), and a third will clear it. Probes: we now recognize two sorts of probes: simple clones, and pools. Pools can contain collections of clone probes and subpools. The hybridisation pattern for a pool is the union of the patterns for all its clones and subpools, together with any data attached specifically to itself. You can type the name of a probe into the text entry box (after activating it to yellow by clicking on it), or you can press the Probe button and pick your probe from another window (e.g. a phytsical map window). The Clear button clears any current pattern, deletes a clone name if ones is present, puts you in edit mode, and prepares the "Pattern for clone" entry box for you to type in a clone name. This does not affect any pattern stored as a "surround" for comparison (see below). The arrow keys also work to let you move the active box (outlined in red) around the grid. Hitting the return key corresponds to clicking on the current active box. Menu items are: Quit, Help, Print: as normal. Preserve: as in the phsyical map display. If you select POLY1 again after choosing this option then you get a new window, rather than reusing this one. Center<->Surround: this places the current pattern in a surround to each highlighted box. You can then load a new pattern and compare it to the one stored in the surround. The clear function only affects the central pattern, not the surround, so to clear the surround select Center<->Surround then Clear. Names: shows YAC names at all locations, rather than square boxes. To see the ones at the right you will have to stretch the box very wide (sorry no scrolling yet). If you print when stretched out you get an index sheet for the filter like the one sent out with it. Display probe as tree: shows the current probe in a separate window in tree (plain text) form. Save data with probe: only valid if you have write access and are entering hybridisation data for probes. This lets you save the current pattern with the probe whose name is in the Probe text entry box. Data that is set as weak (light blue) will be saved with "Weak" following the YAC name. When reading in data, if any text is found following the clone name the box will be displayed in light blue, so you could edit this text in a tree update window to be more informative if you wanted. Set cluster range: This value is used to cluster individual hybridizing YAC's into groups that are supposed to correspond to individual loci. The current algorithm essentially tries to find loci such that the centres of all the positive YAC's are within the defined range. This is not strictly correct. The units are physical map bands. Larger values allow more spread out clusters. Stats on KeySet: Applies to current keyset, which should contain probes with hybridisation data. It returns stats on how many clusters of various sorts there are, as a line on the terminal. Change Gridded Clone: doesn't do anything yet. ################################################################### **Read_files Quit, destroys this window. Open File : allows you to choose any file with ending .ace Read until CTRL/C in home window: Reads the whole file or until you type ^C in the window from where you started ACEDB. Under Sunview, ^C does not always work. Why ? Read one item: READS the next object, i.e. until the next empty line. Read one line: Reads just a single line, usually the value of a tag Skip to next item: skips. Double click a file to parse it or use the keyboard to edit the name of the directory. You get those files of the directory ending with .ace or the content of acemenu.wrm if such a file exists in that directory (useful for automatic redirection to subdirectories). ################################################################### **Make_maps The idea is to establish a correspondance between the genetic map and the physical map. This is used later to jump between maps by continuous interpolation between the cloned genes. This function should be run whenever the genetic map, the clone map or the amount of known sequences have changed appreciably. Quit, destroys this window. Help, displays this help page. Print, prepares a Post Script file pmapxxx.PS in ./PS You can then print it on your local laser printer. Make pMaps recalculates the display of all the contigs for future fast access. Make gMaps recalculates the display of all the chromosomes for future fast access. Align contigs : tries to align the contigs on the chromosomes and report inconsistencies. Bump contigs : bumps them for a nicer, not necessarilly more accurate, display. #################################################################### **Physical_map_calculation This program tries to analyse the clone map, also called physical map It is quite primitive and not linked in distribution 1.4 Quit: Destroys this window. Help: Displays this help page. Print: Prepares a Post Script file defdata.PS in ./PS You can then print it on your local laser printer. Make pMaps should be used to recalculate the contigs after updating the clones Align maps is itself a subprogram The other buttons as a whole make a program and should be used in sequence. ################################################################## **Deficiency_map This program tries to compute a genetic map using deficiency data. Quit: Destroys this window. Help: Displays this help page. Print: Prepares a Post Script file defdata.PS in ./PS You can then print it on your local laser printer. Parse database: Must be run once, when you have changed the 2_point_data It looks for deficiency data and reorgaizes them internally for later use by this package. In particular, genes and def are sorted into contigs defined as a set of genes and deficiencies tested against each other. Read file: This allows you to run the same analysis on some data that you do not want to parse into your database. The data file should consist of ND+1 lines of NM symbols 1 or 0 where NM is the number of markers and ND the number of deficiencies. A 1 indicates that the deficiency uncovers the gene. The first line indicates which genes to take into account. It should have NM 1 to use everything, any 0 will discard the corresponding column. i.e. gene from the analysis. One can also impose the order of subgroups and block some genes together. An example input file is given in the next help page. Get contig: Ask for a contig number. If you give a bad answer, it does not matter. The number of contigs is specified when you Parse the database. Cost: Gives the cost of the running order of the marker, The cost function is n for a deficiency splitted in n+1 discontinuous pieces There is also a way to impose the order of some of the markers, but I this is not yet done in a smooth way. Shuffle: Reshuffles the markers before a new try. Monte Carlo; Inserts the markers one by one in an expanding list. It tries to keep the cost to a minimum and remembers n previous configurations, n is a parameter asked from the user. We had fast and good results with NM = ND = about 20 and n = 5 This is a monte carlo, so you must repeat the search several times. Once a good solution is found, it will no longer print the bad ones. With NM = ND around 100, n = 8, it was very slow but the results were rather good. Intrinsic tree: This is an independant fast and innacurate algorithm to reorder the genes. It should be completed by the next button: Refine tree: This should better the results of the preceeding button but is not yet available. Map: Creates a new window with a useful graphic presentation of the data. It is interesting even on the standard data, before selecting the order option. The Map graph has its own menu with the usual options Quit-Help-Print. The Help is the same one. Quit quits the application. Print prepares defmapxxx.PS. With NM = ND = 100, the resulting graph will not be printed on my laser, probably it is a font problem, sorry. Histo: Plots the marginal ditributions : Histogram of the number of deficiencies carrying a given number of markers and vice versa #################################################################### **Example_of_a_def_dup_data_file Charles Theillet, le 18 septembre 1991, donnees de genetique humaine analysables par acedb 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 1 1 1 1 1 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 0 1 0 0 0 0 0 0 1 0 0 0 1 1 0 0 1 1 1 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 1 1 0 0 1 1 1 1 1 1 1 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 1 1 1 1 1 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 1 0 1 1 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 1 1 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 1 1 1 1 1 1 0 1 0 0 0 0 0 0 0 1 0 1 0 1 0 0 1 1 1 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 1 0 0 0 1 1 0 0 0 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 0 1 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 0 0 0 1 0 BLOCKS these blocks are ordered left to right in the present code 0,2 12,18 ORDER 0,2,3,11 3,11,12,18 12,18,19,23 #################################################################### **WCS WCS is the Worm Community System of Schatz et al. (Arizona) Mail schatz@cs.arizona.edu to get further info on WCS. To access WCS from ACEDB, you must run under X-windows, and start both ACEDB and WCS. Whenever the 2 programs run on the same X server (i.e. your terminal), even if from different clients (for example acedb running in Cambridge and WCS in Arizona, your terminal being in New York) the main ACEDB menu changes and you get 3 more entries as follows. WCS Annotate : Sends an annotation to WCS. WCS Show : Asks WCS for an eventual annotation. WCS Search : Use an object name as a search string in WCS #################################################################### **Official_Update The one functional button is "Next Update", which adds the next official update if it is in $ACEDB_DATA, or if that is not defined, in $ACEDB/rawdata. A record of what is going on will appear in the window. If the system runs out of space in its disk file it will ask you for more. You can add several updates in a row if you have them. If there are any problems then you will be thrown out of the whole program, with an error message. You must have write access, i.e. your login name must be listed in the file $ACEDB/wspec/passwd.wrm to run this function. #################################################################### **Long-Text A simple tool to store and display texts longer than a few lines ################################################################### **Session_control Not yet publicly released. #################################################################### ###################################################################