# Copyright 2013 by Zheng Ruan (zruan1991@gmail.com). # All rights reserved. # This code is part of the Biopython distribution and governed by its # license. Please see the LICENSE file that should have been included # as part of this package. """Code for dealing with Codon Alignment. """ from __future__ import print_function from Bio import BiopythonWarning from Bio import BiopythonExperimentalWarning try: from itertools import izip except ImportError: izip = zip # from itertools import izip from Bio.SeqRecord import SeqRecord from Bio.codonalign.codonseq import CodonSeq from Bio.codonalign.codonalignment import CodonAlignment, mktest from Bio.codonalign.codonalphabet import CodonAlphabet from Bio.codonalign.codonalphabet import default_codon_table, default_codon_alphabet from Bio.codonalign.codonalphabet import get_codon_alphabet as _get_codon_alphabet import warnings warnings.warn('Bio.codonalign is an experimental module which may undergo ' 'significant changes prior to its future official release.', BiopythonExperimentalWarning) def build(pro_align, nucl_seqs, corr_dict=None, gap_char='-', unknown='X', codon_table=default_codon_table, alphabet=None, complete_protein=False, anchor_len=10, max_score=10): """Build a codon alignment from a protein alignment and corresponding nucleotide sequences Arguments: - pro_align - a protein MultipleSeqAlignment object - nucl_align - an object returned by SeqIO.parse or SeqIO.index or a collection of SeqRecord. - alphabet - alphabet for the returned codon alignment - corr_dict - a dict that maps protein id to nucleotide id - complete_protein - whether the sequence begins with a start codon - frameshift - whether to apply frameshift detection Return a CodonAlignment object >>> from Bio.Alphabet import IUPAC >>> from Bio.Seq import Seq >>> from Bio.SeqRecord import SeqRecord >>> from Bio.Align import MultipleSeqAlignment >>> seq1 = SeqRecord(Seq('TCAGGGACTGCGAGAACCAAGCTACTGCTGCTGCTGGCTGCGCTCTGCGCCGCAGGTGGGGCGCTGGAG', ... alphabet=IUPAC.IUPACUnambiguousDNA()), id='pro1') >>> seq2 = SeqRecord(Seq('TCAGGGACTTCGAGAACCAAGCGCTCCTGCTGCTGGCTGCGCTCGGCGCCGCAGGTGGAGCACTGGAG', ... alphabet=IUPAC.IUPACUnambiguousDNA()), id='pro2') >>> pro1 = SeqRecord(Seq('SGTARTKLLLLLAALCAAGGALE', alphabet=IUPAC.protein),id='pro1') >>> pro2 = SeqRecord(Seq('SGTSRTKRLLLLAALGAAGGALE', alphabet=IUPAC.protein),id='pro2') >>> aln = MultipleSeqAlignment([pro1, pro2]) >>> codon_aln = build(aln, [seq1, seq2]) >>> print(codon_aln) CodonAlphabet(Standard) CodonAlignment with 2 rows and 69 columns (23 codons) TCAGGGACTGCGAGAACCAAGCTACTGCTGCTGCTGGCTGCGCTCTGCGCCGCAGGT...GAG pro1 TCAGGGACTTCGAGAACCAAGCG-CTCCTGCTGCTGGCTGCGCTCGGCGCCGCAGGT...GAG pro2 """ # TODO # add an option to allow the user to specify the returned object? from Bio.Alphabet import ProteinAlphabet from Bio.Align import MultipleSeqAlignment # check the type of object of pro_align if not isinstance(pro_align, MultipleSeqAlignment): raise TypeError("the first argument should be a MultipleSeqAlignment " "object") # check the alphabet of pro_align for pro in pro_align: if not isinstance(pro.seq.alphabet, ProteinAlphabet): raise TypeError("Alphabet Error!\nThe input alignment should be " "a *PROTEIN* alignment") if alphabet is None: alphabet = _get_codon_alphabet(codon_table, gap_char=gap_char) # check whether the number of seqs in pro_align and nucl_seqs is # the same pro_num = len(pro_align) if corr_dict is None: if nucl_seqs.__class__.__name__ == "generator": # nucl_seqs will be a tuple if read by SeqIO.parse() nucl_seqs = tuple(nucl_seqs) nucl_num = len(nucl_seqs) if pro_num > nucl_num: raise ValueError("Higher Number of SeqRecords in Protein Alignment " "({0}) than the Number of Nucleotide SeqRecords " "({1}) are found!".format(pro_num, nucl_num)) # Determine the protein sequences and nucl sequences # correspondence. If nucl_seqs is a list, tuple or read by # SeqIO.parse(), we assume the order of sequences in pro_align # and nucl_seqs are the same. If nucl_seqs is a dict or read by # SeqIO.index(), we match seqs in pro_align and those in # nucl_seq by their id. if nucl_seqs.__class__.__name__ in ("_IndexedSeqFileDict", "dict"): corr_method = 1 elif nucl_seqs.__class__.__name__ in ("list", "tuple"): corr_method = 0 else: raise TypeError("Nucl Sequences Error, Unknown type to assign " "correspondence method") else: if not isinstance(corr_dict, dict): raise TypeError("corr_dict should be a dict that corresponds " "protein id to nucleotide id!") if len(corr_dict) >= pro_num: # read by SeqIO.parse() if nucl_seqs.__class__.__name__ == "generator": from Bio import SeqIO nucl_seqs = SeqIO.to_dict(nucl_seqs) elif nucl_seqs.__class__.__name__ in ("list", "tuple"): nucl_seqs = dict((i.id, i) for i in nucl_seqs) # nucl_seqs = {i.id: i for i in nucl_seqs} elif nucl_seqs.__class__.__name__ in \ ("_IndexedSeqFileDict", "dict"): pass else: raise TypeError("Nucl Sequences Error, Unknown type of " "Nucleotide Records!") corr_method = 2 else: raise RuntimeError("Number of items in corr_dict ({0}) is less " "than number of protein records " "({1})".format(len(corr_dict), pro_num)) # set up pro-nucl correspondence based on corr_method # corr_method = 0, consecutive pairing if corr_method == 0: pro_nucl_pair = izip(pro_align, nucl_seqs) # corr_method = 1, keyword pairing elif corr_method == 1: nucl_id = set(nucl_seqs.keys()) pro_id = set(i.id for i in pro_align) # check if there is pro_id that does not have a nucleotide match if pro_id - nucl_id: diff = pro_id - nucl_id raise ValueError("Protein Record {0} cannot find a nucleotide " "sequence match, please check the " "id".format(', '.join(diff))) else: pro_nucl_pair = [] for pro_rec in pro_align: pro_nucl_pair.append((pro_rec, nucl_seqs[pro_rec.id])) # corr_method = 2, dict pairing elif corr_method == 2: pro_nucl_pair = [] for pro_rec in pro_align: try: nucl_id = corr_dict[pro_rec.id] except KeyError: print("Protein record (%s) is not in corr_dict!" % pro_rec.id) exit(1) pro_nucl_pair.append((pro_rec, nucl_seqs[nucl_id])) codon_aln = [] shift = False for pair in pro_nucl_pair: # Beware that the following span corresponds to an ungapped # nucleotide sequence. corr_span = _check_corr(pair[0], pair[1], gap_char=gap_char, codon_table=codon_table, complete_protein=complete_protein, anchor_len=anchor_len) if not corr_span: raise ValueError("Protein Record {0} and Nucleotide Record {1} do" " not match!".format((pair[0].id, pair[1].id))) else: codon_rec = _get_codon_rec(pair[0], pair[1], corr_span, alphabet=alphabet, complete_protein=False, codon_table=codon_table, max_score=max_score) codon_aln.append(codon_rec) if corr_span[1] == 2: shift = True if shift: return CodonAlignment(_align_shift_recs(codon_aln), alphabet=alphabet) else: return CodonAlignment(codon_aln, alphabet=alphabet) def _codons2re(codons): """Generate regular expression based on a given list of codons """ reg = '' for i in izip(*codons): if len(set(i)) == 1: reg += ''.join(set(i)) else: reg += '[' + ''.join(set(i)) + ']' return reg def _get_aa_regex(codon_table, stop='*', unknown='X'): """Set up the regular expression of a given CodonTable for further use. >>> from Bio.Data.CodonTable import generic_by_id >>> p = generic_by_id[1] >>> t = _get_aa_regex(p) >>> print(t['A'][0]) G >>> print(t['A'][1]) C >>> print(sorted(list(t['A'][2:]))) ['A', 'C', 'G', 'T', 'U', '[', ']'] >>> print(sorted(list(t['L'][:5]))) ['C', 'T', 'U', '[', ']'] >>> print(sorted(list(t['L'][5:9]))) ['T', 'U', '[', ']'] >>> print(sorted(list(t['L'][9:]))) ['A', 'C', 'G', 'T', 'U', '[', ']'] """ from Bio.Data.CodonTable import CodonTable if not isinstance(codon_table, CodonTable): raise TypeError("Input table is not a instance of " "Bio.Data.CodonTable object") aa2codon = {} for codon, aa in codon_table.forward_table.items(): aa2codon.setdefault(aa, []).append(codon) for aa, codons in aa2codon.items(): aa2codon[aa] = _codons2re(codons) aa2codon[stop] = _codons2re(codon_table.stop_codons) aa2codon[unknown] = '...' return aa2codon def _check_corr(pro, nucl, gap_char='-', codon_table=default_codon_table, complete_protein=False, anchor_len=10): """check if a give protein SeqRecord can be translated by another nucleotide SeqRecord. """ import re from Bio.Alphabet import NucleotideAlphabet if not isinstance(pro, SeqRecord) or not isinstance(nucl, SeqRecord): raise TypeError("_check_corr accepts two SeqRecord object. Please " "check your input.") def get_alpha(alpha): if hasattr(alpha, 'alphabet'): return get_alpha(alpha.alphabet) else: return alpha if not isinstance(get_alpha(nucl.seq.alphabet), NucleotideAlphabet): raise TypeError("Alphabet for nucl should be an instance of " "NucleotideAlphabet, {0} " "detected".format(str(nucl.seq.alphabet))) aa2re = _get_aa_regex(codon_table) pro_re = "" for aa in pro.seq: if aa != gap_char: pro_re += aa2re[aa] nucl_seq = str(nucl.seq.upper().ungap(gap_char)) match = re.search(pro_re, nucl_seq) if match: # mode = 0, direct match return (match.span(), 0) else: # Might caused by mismatches or frameshift, using anchors to # have a try # anchor_len = 10 # adjust this value to test performance pro_seq = str(pro.seq).replace(gap_char, "") anchors = [pro_seq[i:(i + anchor_len)] for i in range(0, len(pro_seq), anchor_len)] # if the last anchor is less than the specified anchor # size, we combine the penultimate and the last anchor # together as the last one. # TODO: modify this to deal with short sequence with only # one anchor. if len(anchors[-1]) < anchor_len: anchors[-1] = anchors[-2] + anchors[-1] pro_re = [] anchor_distance = 0 anchor_pos = [] for i, anchor in enumerate(anchors): this_anchor_len = len(anchor) qcodon = "" fncodon = "" # dirty code to deal with the last anchor # as the last anchor is combined in the steps # above, we need to get the true last anchor to # pro_re if this_anchor_len == anchor_len: for aa in anchor: if complete_protein and i == 0: qcodon += _codons2re(codon_table.start_codons) fncodon += aa2re['X'] continue qcodon += aa2re[aa] fncodon += aa2re['X'] match = re.search(qcodon, nucl_seq) elif this_anchor_len > anchor_len: last_qcodon = "" last_fcodon = "" for j in range(anchor_len, len(anchor)): last_qcodon += aa2re[anchor[j]] last_fcodon += aa2re['X'] match = re.search(last_qcodon, nucl_seq) # build full_pro_re from anchors if match: anchor_pos.append((match.start(), match.end(), i)) if this_anchor_len == anchor_len: pro_re.append(qcodon) else: pro_re.append(last_qcodon) else: if this_anchor_len == anchor_len: pro_re.append(fncodon) else: pro_re.append(last_fcodon) full_pro_re = "".join(pro_re) match = re.search(full_pro_re, nucl_seq) if match: # mode = 1, mismatch return (match.span(), 1) else: # check frames of anchors # ten frameshift events are allowed in a sequence first_anchor = True shift_id_pos = 0 # check the first anchor if first_anchor and anchor_pos[0][2] != 0: shift_val_lst = [1, 2, 3 * anchor_len - 2, 3 * anchor_len - 1, 0] sh_anc = anchors[0] for shift_val in shift_val_lst: if shift_val == 0: qcodon = None break if shift_val in (1, 2): sh_nuc_len = anchor_len * 3 + shift_val elif shift_val in (3 * anchor_len - 2, 3 * anchor_len - 1): sh_nuc_len = anchor_len * 3 - (3 * anchor_len - shift_val) if anchor_pos[0][0] >= sh_nuc_len: sh_nuc = nucl_seq[anchor_pos[0][0] - sh_nuc_len:anchor_pos[0][0]] else: # this is unlikely to produce the correct output sh_nuc = nucl_seq[:anchor_pos[0][0]] qcodon, shift_id_pos = _get_shift_anchor_re(sh_anc, sh_nuc, shift_val, aa2re, anchor_len, shift_id_pos) if qcodon is not None and qcodon != -1: # pro_re[0] should be '.'*anchor_len, therefore I # replace it. pro_re[0] = qcodon break if qcodon == -1: warnings.warn("first frameshift detection failed for " "{0}".format(nucl.id), BiopythonWarning) # check anchors in the middle for i in range(len(anchor_pos) - 1): shift_val = (anchor_pos[i + 1][0] - anchor_pos[i][0]) % \ (3 * anchor_len) sh_anc = "".join(anchors[anchor_pos[i][2]:anchor_pos[i + 1][2]]) sh_nuc = nucl_seq[anchor_pos[i][0]:anchor_pos[i + 1][0]] qcodon = None if shift_val != 0: qcodon, shift_id_pos = _get_shift_anchor_re(sh_anc, sh_nuc, shift_val, aa2re, anchor_len, shift_id_pos) if qcodon is not None and qcodon != -1: pro_re[anchor_pos[i][2]:anchor_pos[i + 1][2]] = [qcodon] qcodon = None elif qcodon == -1: warnings.warn("middle frameshift detection failed for " "{0}".format(nucl.id), BiopythonWarning) # check the last anchor if anchor_pos[-1][2] + 1 == len(anchors) - 1: sh_anc = anchors[-1] this_anchor_len = len(sh_anc) shift_val_lst = [1, 2, 3 * this_anchor_len - 2, 3 * this_anchor_len - 1, 0] for shift_val in shift_val_lst: if shift_val == 0: qcodon = None break if shift_val in (1, 2): sh_nuc_len = this_anchor_len * 3 + shift_val elif shift_val in \ (3 * this_anchor_len - 2, 3 * this_anchor_len - 1): sh_nuc_len = this_anchor_len * 3 - (3 * this_anchor_len - shift_val) if len(nucl_seq) - anchor_pos[-1][0] >= sh_nuc_len: sh_nuc = nucl_seq[anchor_pos[-1][0]:anchor_pos[-1][0] + sh_nuc_len] else: # this is unlikely to produce the correct output sh_nuc = nucl_seq[anchor_pos[-1][0]:] qcodon, shift_id_pos = _get_shift_anchor_re(sh_anc, sh_nuc, shift_val, aa2re, this_anchor_len, shift_id_pos) if qcodon is not None and qcodon != -1: pro_re.pop() pro_re[-1] = qcodon break if qcodon == -1: warnings.warn("last frameshift detection failed for " "{0}".format(nucl.id), BiopythonWarning) # try global match full_pro_re = "".join(pro_re) match = re.search(full_pro_re, nucl_seq) if match: return (match.span(), 2, match) else: raise RuntimeError("Protein SeqRecord ({0}) and Nucleotide " "SeqRecord ({1}) do not " "match!".format((pro.id, nucl.id))) def _get_shift_anchor_re(sh_anc, sh_nuc, shift_val, aa2re, anchor_len, shift_id_pos): """This function tries all the best to come up with an re that matches a potentially shifted anchor. Arguments: - sh_anc - shifted anchor sequence - sh_nuc - potentially corresponding nucleotide sequence of sh_anc - shift_val - 1 or 2 indicates forward frame shift, whereas 3*anchor_len-1 or 3*anchor_len-2 indicates backward shift - aa2re - aa to codon re dict - anchor_len - length of the anchor - shift_id_pos - specify current shift name we are at """ import re shift_id = [chr(i) for i in range(97, 107)] if 0 < shift_val < 3 * anchor_len - 2: # if shift_val in (1, 2): for j in range(len(sh_anc)): qcodon = "^" for k, aa in enumerate(sh_anc): if k == j: qcodon += aa2re[aa] + "(?P<" + shift_id[shift_id_pos] + ">..*)" else: qcodon += aa2re[aa] qcodon += "$" match = re.search(qcodon, sh_nuc) if match: qcodon = qcodon.replace('^', '').replace('$', '') shift_id_pos += 1 return qcodon, shift_id_pos if not match: # failed to find a match (frameshift) return -1, shift_id_pos elif shift_val in (3 * anchor_len - 1, 3 * anchor_len - 2): shift_val = 3 * anchor_len - shift_val # obtain shifted anchor and corresponding nucl # first check if the shifted pos is just at the end of the # previous anchor. for j in range(1, len(sh_anc)): qcodon = "^" for k, aa in enumerate(sh_anc): if k == j - 1: # will be considered in the next step pass elif k == j: qcodon += _merge_aa2re( sh_anc[j - 1], sh_anc[j], shift_val, aa2re, shift_id[shift_id_pos].upper()) else: qcodon += aa2re[aa] qcodon += '$' match = re.search(qcodon, sh_nuc) if match: qcodon = qcodon.replace('^', '').replace('$', '') shift_id_pos += 1 return qcodon, shift_id_pos if not match: # failed to find a match (frameshift) return -1, shift_id_pos def _merge_aa2re(aa1, aa2, shift_val, aa2re, reid): """Function to merge two amino acids based on detected frame shift value. """ def get_aa_from_codonre(re_aa): aas = [] m = 0 for i in re_aa: if i == '[': m = -1 aas.append('') elif i == ']': m = 0 continue elif m == -1: aas[-1] = aas[-1] + i elif m == 0: aas.append(i) return aas scodon = list(map(get_aa_from_codonre, (aa2re[aa1], aa2re[aa2]))) if shift_val == 1: intersect = ''.join(set(scodon[0][2]) & set(scodon[1][0])) scodonre = '(?P<' + reid + '>' scodonre += '[' + scodon[0][0] + ']' + \ '[' + scodon[0][1] + ']' + \ '[' + intersect + ']' + \ '[' + scodon[1][1] + ']' + \ '[' + scodon[1][2] + ']' elif shift_val == 2: intersect1 = ''.join(set(scodon[0][1]) & set(scodon[1][0])) intersect2 = ''.join(set(scodon[0][2]) & set(scodon[1][1])) scodonre = '(?P<' + reid + '>' scodonre += '[' + scodon[0][0] + ']' + \ '[' + intersect1 + ']' + \ '[' + intersect2 + ']' + \ '[' + scodon[1][2] + ']' scodonre += ')' return scodonre def _get_codon_rec(pro, nucl, span_mode, alphabet, gap_char="-", codon_table=default_codon_table, complete_protein=False, max_score=10): """Generate codon alignment based on regular re match (PRIVATE) span_mode is a tuple returned by _check_corr. The first element is the span of a re search, and the second element is the mode for the match. mode - 0: direct match - 1: mismatch (no indels) - 2: frameshift """ import re from Bio.Seq import Seq nucl_seq = nucl.seq.ungap(gap_char) codon_seq = "" span = span_mode[0] mode = span_mode[1] aa2re = _get_aa_regex(codon_table) if mode in (0, 1): if len(pro.seq.ungap(gap_char)) * 3 != (span[1] - span[0]): raise ValueError("Protein Record {0} and Nucleotide Record {1} " "do not match!".format((pro.id, nucl.id))) aa_num = 0 for aa in pro.seq: if aa == "-": codon_seq += "---" elif complete_protein and aa_num == 0: this_codon = nucl_seq._data[span[0]:span[0] + 3] if not re.search(_codons2re[codon_table.start_codons], this_codon.upper()): max_score -= 1 warnings.warn("start codon of {0} ({1} {2}) does not " "correspond to {3} " "({4})".format(pro.id, aa, aa_num, nucl.id, this_codon), BiopythonWarning) if max_score == 0: raise RuntimeError("max_score reached for {0}! Please " "raise up the tolerance to get an " "alignment in anyway".format(nucl.id)) codon_seq += this_codon aa_num += 1 else: this_codon = nucl_seq._data[(span[0] + 3 * aa_num): (span[0] + 3 * (aa_num + 1))] if not str(Seq(this_codon.upper()).translate(table=codon_table)) == aa: max_score -= 1 warnings.warn("%s(%s %d) does not correspond to %s(%s)" % (pro.id, aa, aa_num, nucl.id, this_codon), BiopythonWarning) if max_score == 0: raise RuntimeError("max_score reached for {0}! Please " "raise up the tolerance to get an " "alignment in anyway".format(nucl.id)) codon_seq += this_codon aa_num += 1 return SeqRecord(CodonSeq(codon_seq, alphabet=alphabet), id=nucl.id) elif mode == 2: from collections import deque shift_pos = deque([]) shift_start = [] match = span_mode[2] m_groupdict = list(match.groupdict().keys()) # backward frameshift for i in m_groupdict: shift_pos.append(match.span(i)) shift_start.append(match.start(i)) rf_table = [] i = match.start() while True: rf_table.append(i) i += 3 if i in shift_start and \ m_groupdict[shift_start.index(i)].isupper(): shift_index = shift_start.index(i) shift_val = 6 - (shift_pos[shift_index][1] - shift_pos[shift_index][0]) rf_table.append(i) rf_table.append(i + 3 - shift_val) i = shift_pos[shift_index][1] elif i in shift_start and \ m_groupdict[shift_start.index(i)].islower(): i = shift_pos[shift_start.index(i)][1] if i >= match.end(): break aa_num = 0 for aa in pro.seq: if aa == "-": codon_seq += "---" elif complete_protein and aa_num == 0: this_codon = nucl_seq._data[rf_table[0]:rf_table[0] + 3] if not re.search(_codons2re[codon_table.start_codons], this_codon.upper()): max_score -= 1 warnings.warn("start codon of {0}({1} {2}) does not " "correspond to {3}({4})".format( pro.id, aa, aa_num, nucl.id, this_codon), BiopythonWarning) codon_seq += this_codon aa_num += 1 else: if aa_num < len(pro.seq.ungap('-')) - 1 and \ rf_table[aa_num + 1] - rf_table[aa_num] - 3 < 0: max_score -= 1 start = rf_table[aa_num] end = start + (3 - shift_val) ngap = shift_val this_codon = nucl_seq._data[start:end] + '-' * ngap elif rf_table[aa_num] - rf_table[aa_num - 1] - 3 > 0: max_score -= 1 start = rf_table[aa_num - 1] + 3 end = rf_table[aa_num] ngap = 3 - (rf_table[aa_num] - rf_table[aa_num - 1] - 3) this_codon = nucl_seq._data[start:end] + '-' * ngap + \ nucl_seq._data[rf_table[aa_num]:rf_table[aa_num] + 3] else: start = rf_table[aa_num] end = start + 3 this_codon = nucl_seq._data[start:end] if not str(Seq(this_codon.upper()).translate(table=codon_table)) == aa: max_score -= 1 warnings.warn("Codon of {0}({1} {2}) does not " "correspond to {3}({4})".format( pro.id, aa, aa_num, nucl.id, this_codon), BiopythonWarning) if max_score == 0: raise RuntimeError("max_score reached for {0}! Please " "raise up the tolerance to get an " "alignment in anyway".format(nucl.id)) codon_seq += this_codon aa_num += 1 return SeqRecord(CodonSeq(codon_seq, alphabet=alphabet, rf_table=rf_table), id=nucl.id) def _align_shift_recs(recs): """This function is useful to build alignment according to the frameshift detected by _check_corr. Argument: - recs - a list of SeqRecords containing a CodonSeq dictated by a rf_table (with frameshift in some of them). """ def find_next_int(k, lst): idx = lst.index(k) p = 0 while True: if isinstance(lst[idx + p], int): return lst[idx + p], p p += 1 full_rf_table_lst = [rec.seq.get_full_rf_table() for rec in recs] rf_num = [0] * len(recs) for k, rec in enumerate(recs): for i in rec.seq.get_full_rf_table(): if isinstance(i, int): rf_num[k] += 1 # isinstance(i, float) should be True elif rec.seq._data[int(i):int(i) + 3] == "---": rf_num[k] += 1 if len(set(rf_num)) != 1: raise RuntimeError("Number alignable codons unequal in given records") i = 0 rec_num = len(recs) while True: add_lst = [] try: col_rf_lst = [k[i] for k in full_rf_table_lst] except IndexError: # we probably reached the last codon break for j, k in enumerate(col_rf_lst): add_lst.append((j, int(k))) if isinstance(k, float) and \ recs[j].seq._data[int(k):int(k) + 3] != "---": m, p = find_next_int(k, full_rf_table_lst[j]) if (m - k) % 3 != 0: gap_num = 3 - (m - k) % 3 else: gap_num = 0 if gap_num != 0: gaps = '-' * int(gap_num) seq = recs[j].seq._data[:int(k)] + gaps + \ recs[j].seq._data[int(k):] full_rf_table = full_rf_table_lst[j] bp = full_rf_table.index(k) full_rf_table = full_rf_table[:bp] + \ [v + int(gap_num) for v in full_rf_table[bp + 1:]] full_rf_table_lst[j] = full_rf_table recs[j].seq = CodonSeq(seq, rf_table=recs[j].seq.rf_table, alphabet=recs[j].seq.alphabet) add_lst.pop() gap_num += m - k i += p - 1 if len(add_lst) != rec_num: for j, k in add_lst: gaps = "-" * int(gap_num) seq = recs[j].seq._data[:int(k)] + gaps + \ recs[j].seq._data[int(k):] full_rf_table = full_rf_table_lst[j] bp = full_rf_table.index(k) inter_rf = [] for t in filter(lambda x: x % 3 == 0, range(len(gaps))): inter_rf.append(k + t + 3.0) full_rf_table = full_rf_table[:bp] + inter_rf + \ [v + int(gap_num) for v in full_rf_table[bp:]] full_rf_table_lst[j] = full_rf_table recs[j].seq = CodonSeq(seq, rf_table=recs[j].seq.rf_table, alphabet=recs[j].seq.alphabet) i += 1 return recs # def toCodonAlignment(align, alphabet=default_codon_alphabet): # """Function to convert a MultipleSeqAlignment to CodonAlignment. # It is the user's responsibility to ensure all the requirement # needed by CodonAlignment is met. # # """ # rec = [SeqRecord(CodonSeq(str(i.seq), alphabet=alphabet), id=i.id) \ # for i in align._records] # return CodonAlignment(rec, alphabet=align._alphabet) if __name__ == "__main__": from Bio._utils import run_doctest run_doctest()