# Copyright 2008-2016 by Peter Cock. All rights reserved. # This code is part of the Biopython distribution and governed by its # license. Please see the LICENSE file that should have been included # as part of this package. """Testing online code for fetching NCBI qblast. Uses Bio.Blast.NCBIWWW.qblast() to run some online blast queries, get XML blast results back, and then checks Bio.Blast.NCBIXML.parse() can read them. Goals: Make sure that all retrieval is working as expected. Make sure we can parse the latest XML format being used by the NCBI. """ from __future__ import print_function import unittest from Bio._py3k import HTTPError from Bio._py3k import StringIO from Bio import MissingExternalDependencyError # We want to test these: from Bio.Blast import NCBIWWW from Bio.Blast import NCBIXML import requires_internet requires_internet.check() ##################################################################### # List of qblast requests stored as a tuple of parameters: # - program # - database # - query identifier or sequence # - expectation value threshold # - Entrez filter string (or None) # - list of hit identifiers expected to be found (or None if expect 0) print("Checking Bio.Blast.NCBIWWW.qblast() with various queries") class TestQblast(unittest.TestCase): def test_blastp_nr_actin(self): # Simple protein blast filtered for rat only, using protein GI:160837788 # the actin related protein 2/3 complex, subunit 1B [Mus musculus] self.run_qblast("blastp", "nr", "160837788", 0.001, "rat [ORGN]", ['9506405', '13592137', '37589612', '149064087', '56912225']) def test_pcr_primers(self): # This next example finds PCR primer matches in Chimpanzees, e.g. BRCA1: self.run_qblast("blastn", "nr", "GTACCTTGATTTCGTATTC" + ("N" * 30) + "GACTCTACTACCTTTACCC", 10, "pan [ORGN]", ["XM_009432096.2", "XM_009432102.2", "XM_009432101.2", "XM_016930487.1", "XM_009432104.2", "XM_009432099.2", "XR_001710553.1", "XM_016930485.1", "XM_009432089.2", "XM_016930484.1"]) def test_orchid_est(self): # Try an orchid EST (nucleotide) sequence against NR using BLASTX self.run_qblast("blastx", "nr", """>gi|116660609|gb|EG558220.1|EG558220 CR02019H04 Leaf CR02 cDNA library Catharanthus roseus cDNA clone CR02019H04 5', mRNA sequence CTCCATTCCCTCTCTATTTTCAGTCTAATCAAATTAGAGCTTAAAAGAATGAGATTTTTAACAAATAAAA AAACATAGGGGAGATTTCATAAAAGTTATATTAGTGATTTGAAGAATATTTTAGTCTATTTTTTTTTTTT TCTTTTTTTGATGAAGAAAGGGTATATAAAATCAAGAATCTGGGGTGTTTGTGTTGACTTGGGTCGGGTG TGTATAATTCTTGATTTTTTCAGGTAGTTGAAAAGGTAGGGAGAAAAGTGGAGAAGCCTAAGCTGATATT GAAATTCATATGGATGGAAAAGAACATTGGTTTAGGATTGGATCAAAAAATAGGTGGACATGGAACTGTA CCACTACGTCCTTACTATTTTTGGCCGAGGAAAGATGCTTGGGAAGAACTTAAAACAGTTTTAGAAAGCA AGCCATGGATTTCTCAGAAGAAAATGATTATACTTCTTAATCAGGCAACTGATATTATCAATTTATGGCA GCAGAGTGGTGGCTCCTTGTCCCAGCAGCAGTAATTACTTTTTTTTCTCTTTTTGTTTCCAAATTAAGAA ACATTAGTATCATATGGCTATTTGCTCAATTGCAGATTTCTTTCTTTTGTGAATG""", 0.0000001, None, ["21554275", "18409071", "296087288", "566183510"]) def run_qblast(self, program, database, query, e_value, entrez_filter, expected_hits): try: if program == "blastn": # Check the megablast parameter is accepted handle = NCBIWWW.qblast(program, database, query, alignments=10, descriptions=10, hitlist_size=10, entrez_query=entrez_filter, expect=e_value, megablast="FALSE") else: handle = NCBIWWW.qblast(program, database, query, alignments=10, descriptions=10, hitlist_size=10, entrez_query=entrez_filter, expect=e_value) except HTTPError: # e.g. a proxy error raise MissingExternalDependencyError("internet connection failed") record = NCBIXML.read(handle) if record.query == "No definition line": # We used a sequence as the query self.assertEqual(len(query), record.query_letters) elif query.startswith(">"): # We used a FASTA record as the query expected = query[1:].split("\n", 1)[0] self.assertEqual(expected, record.query) elif record.query_id.startswith("Query_") and len(query) == record.query_letters: # We used a sequence as the entry and it was given a placeholder name pass else: # We used an identifier as the query self.assertTrue(query in record.query_id.split("|"), "Expected %r within query_id %r" % (query, record.query_id)) # Check the recorded input parameters agree with those requested self.assertEqual(float(record.expect), e_value) self.assertEqual(record.application.lower(), program) self.assertTrue(len(record.alignments) <= 10) self.assertTrue(len(record.descriptions) <= 10) # Check the expected result(s) are found in the alignments if expected_hits is None: self.assertEqual(len(record.alignments), 0) # Expected no alignments! else: self.assertTrue(len(record.alignments) > 0) # Expected some alignments! found_result = False for expected_hit in expected_hits: for alignment in record.alignments: if expected_hit in alignment.hit_id.split("|"): found_result = True break if len(expected_hits) == 1: print("Update this test to have some redundancy...") for alignment in record.alignments: print(alignment.hit_id) self.assertTrue(found_result, "Missing all expected hits (%s), instead have: %s" % (", ".join(expected_hits), ", ".join(a.hit_id for a in record.alignments))) # Check the expected result(s) are found in the descriptions if expected_hits is None: self.assertEqual(len(record.descriptions), 0) # Expected no descriptions! else: self.assertTrue(len(record.descriptions) > 0) # Expected some descriptions! found_result = False for expected_hit in expected_hits: for descr in record.descriptions: if expected_hit == descr.accession \ or expected_hit in descr.title.split(None, 1)[0].split("|"): found_result = True break assert found_result, "Missing all of %s in descriptions" % expected_hit self.assertTrue(found_result) def test_parse_qblast_ref_page(self): with open("Blast/html_msgid_29_blastx_001.html", "r") as f: handle = StringIO(f.read()) self.assertRaises(ValueError, NCBIWWW._parse_qblast_ref_page, handle) if __name__ == "__main__": runner = unittest.TextTestRunner(verbosity=2) unittest.main(testRunner=runner)