BEGIN_COLORS consed.colorHighlightBackground: Yellow consed.colorHighlightForegroundX: Black consed.colorMeansMatch_same: CadetBlue1 consed.colorMeansMatch_different: Orange consed.colorMeansMatch_clippedEnds: Grey50 consed.colorMeansMatch_consensus: Yellow consed.colorMeansMatch_lowQualConsensus: Gold3 ! for light background !consed.colorConsensusLabel: Blue !consed.colorConsensusLabelBackground: Grey70 consed.colorConsensusLabel: Yellow consed.colorConsensusLabelBackground: Black consed.colorMeansQualityAgree: Black consed.colorMeansQualityDisagree: red2 consed.colorMeansQualityConsensusForeground: Purple4 consed.colorMeansQuality0_4: grey39 consed.colorMeansQuality5_9: grey47 consed.colorMeansQuality10_14: grey54 consed.colorMeansQuality15_19: grey60 consed.colorMeansQuality20_24: grey66 consed.colorMeansQuality25_29: grey77 consed.colorMeansQuality30_34: grey86 consed.colorMeansQuality35_39: grey91 consed.colorMeansQuality40_97: white consed.colorMeansQuality98: grey39 consed.colorMeansQuality99: white consed.colorMeansEditedAgree: Dark Goldenrod consed.colorMeansEditedDisagree: red2 consed.colorMeansEditedUnedited: Black consed.colorMeansEdited98: grey66 consed.colorMeansEdited99: white consed.colorVerticalScrollbarScrolledDown: green consed.colorMode_editCursorForeground: White consed.colorMode_editCursorBackground: Red ! for light background !consed.colorTracesA: chartreuse consed.colorTracesA: chartreuse3 ! for light background !consed.colorTracesC: royal blue consed.colorTracesC: CadetBlue1 ! for light background !consed.colorTracesG: Black consed.colorTracesG: Orange consed.colorTracesT: Red consed.colorTracesN: Purple consed.colorTracesPad: Magenta ! for light background !consed.colorScale: Black consed.colorScale: Yellow ! for light background !consed.colorScaleBackground: Grey70 consed.colorScaleBackground: Black consed.colorHighlightedReadNames: Magenta ! for light background !consed.colorSequencingDirectionArrow: Blue consed.colorSequencingDirectionArrow: Yellow consed.colorSequencingDirectionArrowTracesUp: Magenta consed.colorVerticalLineAtCursor: Green consed.colorHorizontalLineAtCursor: Green consed.colorProteinTranslation: Yellow consed.colorProteinTranslationLabels: Yellow consed.colorProteinStartCodon: deep pink consed.colorProteinStopCodon: deep pink consed.colorUnmatchedRestrictionFragment: Red consed.colorRestrictionFragmentPairTooFarApart: Red consed.colorRestrictionFragmentInContig: black consed.colorRestrictionFragmentPartlyOffContig: yellow consed.colorRestrictionFragmentEntirelyOffContig: blue consed.colorActualGelRestrictionFragment: black consed.colorRestrictionDigestScale: black consed.colorRestrictionDigestCursorIndicator: black consed.colorRestrictionFragmentsOnTopOfEachOther: purple consed.colorAssemblyViewScale: black consed.colorAssemblyViewScaleNumbers: black consed.colorAssemblyViewContigs: grey45 consed.colorAssemblyViewContigNamesForeground: floral white consed.colorAssemblyViewContigNamesBackground: Deep Pink consed.colorAssemblyViewConsistentFwdRevPairs: blue1 consed.colorAssemblyViewConsistentFwdRevPairDepth: green consed.colorAssemblyViewReadDepth: medium sea green consed.colorAssemblyViewDiscrepanciesNotIndels: Yellow consed.colorAssemblyViewDiscrepanciesIndels: Magenta consed.colorAssemblyViewTooFewConsistentFwdRevPairs: red2 consed.colorAssemblyViewInconsistentFwdRevPair: red2 consed.colorAssemblyViewConsistentGapSpanningFwdRevPair: cyan4 consed.colorAssemblyViewHighlight: yellow consed.colorAssemblyViewMultipleItemsOnTopOfEachOther: purple consed.colorAssemblyViewDirectSequenceMatches: darkorange consed.colorAssemblyViewInvertedSequenceMatches: black consed.colorAssemblyViewConsistentRestrictionDigestFragment1: cyan1 consed.colorAssemblyViewConsistentRestrictionDigestFragment2: forest green consed.colorAssemblyViewConsistentRestrictionDigestFragment3: pale green consed.colorAssemblyViewConsistentRestrictionDigestFragment4: plum consed.colorAssemblyViewConsistentRestrictionDigestFragment5: burlywood consed.colorAssemblyViewConsistentRestrictionDigestFragment6: medium sea green consed.colorAssemblyViewConsistentRestrictionDigestFragment7: peachpuff3 consed.colorAssemblyViewConsistentRestrictionDigestFragment8: plum consed.colorAssemblyViewConsistentRestrictionDigestFragment9: khaki consed.colorAssemblyViewConsistentRestrictionDigestFragment10: tan consed.colorAssemblyViewInconsistentRestrictionDigestFragment: red consed.colorAssemblyViewCloneEnd: light coral consed.colorReadPrefixDefault: blue END_COLORS BEGIN_TAGS // tag name // whether tag is read tag, consensus tag, or both // true or false (whether user can create tag by swiping consed.tagColorEdit: DarkOliveGreen1 both false consed.tagColorBecomeConsensus: NavajoWhite3 read false consed.tagColorIgnoreMismatches: SeaGreen1 read false consed.tagColorIgnoreMatches: orange read false consed.tagColorSignificantDiscrepancy: Plum1 read false consed.tagColorCompression: brown3 read true consed.tagColorDataNeeded: gold consensus true consed.tagColorComment: SkyBlue1 both true consed.tagColorTagsOverlap: magenta4 both false consed.tagColorSequencingVector: LightPink1 both true consed.tagColorCloningVector: Cyan both true consed.tagColorVector: LightSalmon both true consed.tagColorOligo: Yellow consensus true consed.tagColorOligo3PrimeEnd: Red consensus false consed.tagColorChimera: DarkSeaGreen3 read true consed.tagColorContigName: Aquamarine consensus true consed.tagColorPolymorphism: SlateBlue2 both true consed.tagColorHomozygoteAA: SlateBlue2 read true consed.tagColorHomozygoteCC: SlateBlue2 read true consed.tagColorHomozygoteGG: SlateBlue2 read true consed.tagColorHomozygoteTT: SlateBlue2 read true consed.tagColorHeterozygoteAC: Pink read true consed.tagColorHeterozygoteAG: Pink read true consed.tagColorHeterozygoteAT: Pink read true consed.tagColorHeterozygoteCG: Pink read true consed.tagColorHeterozygoteCT: Pink read true consed.tagColorHeterozygoteGT: Pink read true consed.tagColorRepeat: DodgerBlue consensus true consed.tagColorPolyPhredRank1: Red consensus false consed.tagColorPolyPhredRank2: Orange consensus false consed.tagColorPolyPhredRank3: MediumSeaGreen consensus false consed.tagColorPolyPhredRank4: Blue consensus false consed.tagColorPolyPhredRank5: orchid1 consensus false consed.tagColorPolyPhredRank6: purple consensus false // Jim Sloan said not using polyphredrank tags greater than 6. // October 2002 // following added by Jim Sloan, Oct 2002: consed.tagColorIndelSite: DarkCyan consensus true consed.tagColorHeterozygoteIndel: DarkOrange read true consed.tagColorHomozygoteIndel: SlateBlue2 read true consed.tagColorPolymorphismConfirmed: orange both true // phil said (980708) that users cannot create matchElsewhere tags, // but can create G_dropout and compression tags // The last 2 only apply to reads, but matchElsewhere can be either consed.tagColorMatchElsewhereHighQual: green both false consed.tagColorMatchElsewhereLowQual: aquamarine both false consed.tagColorG_dropout: Plum1 read true consed.tagColorMarkedHighQuality: orange read false consed.tagColorMarkedLowQuality: NavajoWhite3 read false consed.tagColorAutoFinishExp: turquoise4 consensus false consed.tagColorDoNotFinish: saddle brown both true consed.tagColorDoNotDoPCR: yellow green both true consed.tagColorConsedFixedGoldenPath: tomato4 both false consed.tagColorCloneEnd: aquamarine both false consed.tagColorEditable: aquamarine consensus true consed.tagColorContigEndPair: RosyBrown1 consensus false // requested by Jim Sloan, Jan 2004 consed.tagColorChangedGenotype: cyan3 read false consed.tagColorStartNumberingConsensus: DarkSeaGreen3 both false // works with consed.numberUnpaddedConsensusAtUserDefined: true consed.tagColorReferenceSequence: yellow read true // designates this sequence the reference sequence for the purpose of // various navigation/polymorphism functions consed.tagColorJoin: chartreuse consensus false // tear tag is hard-coded in addTearTagType.cpp END_TAGS BEGIN_MISC_RESOURCES ! In the following, I have annotated the parameters with the following ! symbols: ! ! (YES) freely customize to your own site ! (OK) don't change unless you have a specific need and know what you ! are doing ! (NO) don't change this! ! (GREEN LAB) Resources here are just those for Green Lab research and have ! no effect on any Consed/Autofinish/AutoReport functions ! ! ! parameters in the (YES) category: ! consed.printPS: true bool ! print memory ! (YES) consed.defaultTagType: polymorphism RWCString ! when swiping the consensus in the Aligned Reads Window to create a ! tag, what is the default tag type to be added? ! (YES) consed.defaultTagOnConsensusNotReads: true bool ! when swiping the consensus in the Aligned Reads Window to create a ! tag, by default will the consensus be tagged or the reads be tagged? ! (YES) consed.autoFinishMinNumberOfErrorsFixedByAnExp: 0.02 double ! if an experiment solves fewer errors than this, it isn't worth doing ! so won't be chosen. This parameter controls when Autofinish stops ! choosing experiments. ! (YES) consed.autoFinishRedundancy: 2.0 double ! This number should be between 1.0 and 2.0 If you want more reads ! for each area, increase the number towards 2.0 If you want fewer ! reads per area, decrease it towards 1.0. This only affects ! universal primer reads--not custom primer reads. ! ! (YES) consed.autoFinishAverageInsertSize: 1500 int ! If a template has a forward but no reverse, when deciding whether to ! allow this template for a particular primer or reverse, we need to ! make an assumption of where is the end of the template. If we have ! do not have enough forward/reverse pairs to determine the mean, then ! this parameter is used. ! (YES) consed.primersMaxInsertSizeOfASubclone: 3000 int // for checking for false-annealing ! check +/- this distance from the primer for false-annealing ! and check at most this distance for templates for a primer. ! Thus if you have more than one library, make this the max of ! all libraries. ! (YES) consed.primersMaxMeltingTemp: 60 int ! (YES) consed.primersMaxMeltingTempForPCR: 58 int ! Note: the difference between consed.primersMaxMeltingTempForPCR and ! consed.primersMinMeltingTempForPCR must be less than or equal to ! consed.primersMaxMeltingTempDifferenceForPCR ! Otherwise, autofinish may take forever to pick pcr primers. ! (YES) consed.primersPickTemplatesForPrimers: true bool ! when picking primers for subclone templates, pick templates also. ! If there is no suitable template for a primer, do not pick the ! primer. If you like to pick your own templates, you might want to ! turn this off for a little improvement in speed. ! This has no effect on Autofinish--just on interactive primer picking ! in Consed. ! (YES) consed.primersSubcloneFullPathnameOfFileOfSequencesForScreening: $CONSED_HOME/lib/screenLibs/primerSubcloneScreen.seq RWCString ! vector sequence file if choosing subclone (e.g., M13, plasmid) ! templates ! (YES) consed.primersCloneFullPathnameOfFileOfSequencesForScreening: $CONSED_HOME/lib/screenLibs/primerCloneScreen.seq RWCString ! vector sequence file if choosing clone (e.g., cosmid, BAC) template ! (YES) consed.primersMinMeltingTemp: 55 int ! (YES) consed.primersMinMeltingTempForPCR: 55 int ! (YES) consed.searchFunctionsUseUnalignedEndsOfReads: false bool ! when navigating by ! searchForSingleSubcloneRegions and searchForSingleStrandedRegions, ! and the read below has both aligned and unaligned portions, which ! bases of the read are considered to cover the region: ! uuuuuuuAAAAAAAAAAAAAAAAAAAAAAAAAuuuuuuuu ! <--------- if "true" ------------------> ! <-----if "false"--------> ! where u means an unaligned base and A means an aligned base ! (YES) consed.searchFunctionsUseLowQualityEndsOfReads: true bool ! when navigating by ! searchForSingleSubcloneRegions and searchForSingleStrandedRegions, ! and the read below has both low quality and high quality portions, ! which portions of the read are considered to cover the region: ! lllllllAAAAAAAAAAAAAAAAAAAAAAAAAllllllll ! <--------- if "true" ------------------> ! <-----if "false"--------> ! where l means a low quality base and A means a high quality base ! (YES) consed.inexactSearchForStringMaxPerCentMismatch: 5 int ! when using the inexact search for string, allow up to this ! % mismatch: the sum of the insertion, deletion, and substitution ! differences divided by the length of the query string ! (YES) consed.onlyAllowOneReadWriteConsedAtATime: false bool ! if there is another read-write consed (or Autofinish) process running in the ! same directory, and this consed (or Autofinish) is not read-only, ! then terminate with an error message ! (YES) consed.autoFinishAllowHighQualityDiscrepanciesInTemplateIfConsistentForwardReversePair: true bool ! otherwise, a single serious hqd will cause the template to be rejected. ! (YES) consed.printWindowCommand: /usr/bin/X11/xwd | /usr/bin/X11/xpr | /bin/lp -dlevulose RWCString ! system command to print out a Consed Window ! (YES) consed.fileOfTagTypes: FileName ! pathname of a file with the following format: ! (tag name) (color for displaying) (consensus or read or both) (yes/no) ! where "consensus" or "read" or "both" indicates whether the tag ! is available for the user to add to the consensus, to reads, or to ! both, and "yes" or "no" indicates whether the tag can be created ! in Consed by swiping, or whether it only can be created by an ! external program and displayed by Consed. ! (YES) consed.assemblyViewShowConsistentFwdRevPairs: false bool ! too many squares! See assemblyViewShowConsistentFwdRevPairDepth ! (YES) consed.assemblyViewShowConsistentFwdRevPairDepth: false bool ! This actually shows more information than ! assemblyViewShowConsistentFwdRevPairs and is much easier to read ! (YES) consed.assemblyViewShowConsistentFwdRevPairsBetweenDifferentScaffolds: true bool ! Lone links from the end of one contig to the end of another, but not ! confirmed by another in order to make the contigs joined into a scaffold. ! (YES) consed.assemblyViewShowLegsOnSquaresForConsistentFwdRevPairs: false bool ! This is even more cluttered than assemblyViewShowConsistentFwdRevPairs ! (YES) consed.assemblyViewShowGapSpanningFwdRevPairs: true bool ! This shows gap-spanning fwd/rev pairs that caused the contigs to ! be joined into a scaffold. ! (YES) consed.assemblyViewShowWhichInconsistentFwdRevPairs: filtered RWCString ! choices are: filtered, none, all ! "filtered" means that an inconsistent fwd/rev pair is only shown ! if it is confirmed by another inconsistent fwd/rev pair ! If all, full of red lines. If filtered, then only red lines that are ! confirmed by other red lines are shown. ! (YES) consed.assemblyViewShowReadDepth: true bool ! If true, read depth is shown in assemblyView ! (YES) consed.assemblyViewShowMultipleHighQualityDiscrepancies: false bool ! If true, multiple high quality discrepancies (both indel and ! non-indel type) are shown in assemblyView ! (YES) consed.assemblyViewShowRestrictionDigestCutSites: true bool ! If true, and you open a Digest Window in Consed and you open ! the Assembly View window in Consed, the restriction digest cut ! sites will be shown in Assembly View (in addition to showing them in ! the Digest Window) ! (YES) consed.assemblyViewFilterSequenceMatchesBySize: false bool ! only show sequence matches if they fall between ! consed.assemblyViewSequenceMatchesMinSize and ! consed.assemblyViewSequenceMatchesMaxSize ! (YES) consed.assemblyViewSequenceMatchesMinSize: 100 int ! if consed.assemblyViewFilterSequenceMatchesBySize is true, ! then only show sequence matches that are larger than this ! (YES) consed.assemblyViewSequenceMatchesMaxSize: 10000 int ! if consed.assemblyViewFilterSequenceMatchesBySize is true, ! then only show sequence matches that are smaller than this ! (YES) consed.assemblyViewAutomaticallyStartWithConsed: false bool ! when consed starts, start assembly view. This only works if you ! specify the ace file on the command line. ! (YES) consed.assemblyViewDisplayTheseTagTypesOnTheseLines: edit 0 matchElsewhereHighQual 1 matchElsewhereLowQual 2 RWCString ! space-separated list of form: ! (tagtype) (line number) (tagtype) (line number) ! where line number is where in Assembly View the tag will be displayed ! (YES) consed.assemblyViewShowTags: true bool ! If true, and some tag types are selected, these tags ! will be shown in assemblyView. If false, no tags ! will be shown in assemblyView. ! (YES) consed.autoEditRecalculateHighQualitySegmentsOfReads: false bool ! If true, will recalculate the high quality segments of the reads ! (YES) consed.autoEditConvertCloneEndBasesToXs: true bool ! If true, will convert to X's bases of all reads that protrude beyond a ! cloneEnd tag. ! (YES) consed.autoEditTellPhrapNotToOverlapMultiplyDiscrepantReads: true bool ! This will find all locations where there are multiple identical ! discrepancies with the consensus (and some other conditions) and try ! to make most of the reads quality 99 at that location so that phrap, ! next time it is run, will not overlap those reads. This will fix ! many misassemblies. ! (YES) consed.autoEditTagEditableLowConsensusQualityRegions: true bool ! This will find regions that are low quality, but that a human ! finisher could easily determine the correct base and thus ! money could be saved by not having Autofinish suggest additional ! reads overlapping the region ! (YES) consed.autoEditMakeFakeRead: false bool ! takes a list of reads and makes a false read that consists of the ! combination of those reads (using the consensus to fill in between ! them) ! (YES) consed.autoEditMakeFakeReadFromRead1: read1 RWCString ! read 1 from which to make the fake read consed.autoEditMakeFakeReadFromRead2: read2 RWCString ! read 2 from which to make the fake read consed.autoEditMakeFakeReadName: mama RWCString ! name of fake read consed.autoEditMakeFakeReadFastaFilename: mama.fa FileName ! name of fasta file to put the read into consed.autoEditMergeAssembly: false bool ! This is used to take 2 assemblies (each with a single contig) that ! have a read in common and merge them into a single assembly with a ! single contig as follows: It reads consed.autoEditSecondaryAceFile ! into a secondary assembly and finds read ! consed.autoEditMakeFakeReadName within that secondary assembly as well ! as within the primary assembly. It assumes that these reads have the ! same unpadded bases (although they may have different pads). It ! equalizes the pads, and then moves the other reads (which are ! typically the fwd/rev pair of reads) from the secondary assembly into ! the primary assembly. It then deletes the secondary assembly and ! deletes consed.autoEditMakeFakeReadName from the primary assembly. ! (YES) consed.autoEditSecondaryAceFile: mama.ace FileName ! ace file of the fake read and the forward/reverse pair consed.autoEditFixRunsInConsensus: false bool ! fixes this: ! ccc (cons) ! cc* (read1) ! *cc (read2) ! (YES) consed.showAllTracesJustShowGoodTraces: true bool ! Just show traces where there is a base at the cursor and ! there is trace signal at the cursor and where ! there is no "dataNeeded" tag at the cursor as specified by ! consed.showAllTracesDoNotShowTraceIfTheseTagsPresent ! (YES) consed.addAlignedSequenceQualityOfBases: 40 int ! when running consed -addAlignedSequence, what quality should the ! bases be? ! (YES) consed.makeLightBackgroundInAlignedReadsWindowAndTracesWindow: false bool ! for printing screens, saves toner ! (YES) consed.putVerticalLineAtCursor: true bool ! for very high depth of coverage regions, a line helps your eye see ! follow the column ! (YES) consed.putHorizontalLineAtCursor: true bool ! for very wide monitors, helps to follow a read with your eye ! (YES) consed.highlightedReadsFile: highlighted_reads.txt FileName ! The user can use the "Misc/save highlighted reads to file" function ! to save highlighted read names to this file. ! (YES) ! ! ! parameters in the (OK) category: ! ! ! consed.autoReportPrintReadNamesInRegion: false bool !(OK) consed.autoReportPrintReadNamesInRegionContig: Contig1 RWCString !(OK) consed.autoReportPrintReadNamesInRegionLeftPos: 1 int !(OK) consed.autoReportPrintReadNamesInRegionRightPos: 1000 int !(OK) consed.autoReportPrintHighlyDiscrepantRegions: false bool ! motivated by solexa reads. Print where many reads disagree with ! reference sequence ! uses: ! consed.qualityThresholdForFindingHighQualityDiscrepancies ! ignores bases lower than this ! consed.navigateByHighlyDiscrepantPositionsMinDiscrepantReads ! consed.navigateByHighlyDiscrepantPositionsMaxDepthOfCoverage ! consed.navigateByHighlyDiscrepantPositionsIgnoreBasesBelowThisQuality ! consed.navigateByHighlyDiscrepantPositionsJustListIndels ! consed.navigateByHighlyDiscrepantPositionsIgnoreIfNOrXInConsensus: false ! (OK) consed.autoReportPrintScaffolds: false bool ! (OK) consed.numberUnpaddedConsensusAtUserDefined: true bool ! allow user to put a tag on the consensus to specify the number to ! start numbering the consensus. ! Must use tag consed.tagColorStartNumberingConsensus as the ! tag with the number in it. ! (OK) consed.autoReportPrintHighQualityDiscrepancies: false bool ! (OK) consed.autoReportHighQualityDiscrepanciesExcludeCompressionOrG_dropoutTags: true bool ! used in connection with consed.autoReportPrintHighQualityDiscrepancies ! (OK) consed.autoReportHighQualityDiscrepanciesExcludeMostPads: true bool ! used in connection with consed.autoReportPrintHighQualityDiscrepancies ! Excludes high quality discrepancy pads except those in cases such as this: ! consensus aa ! read 1 *a ! read 2 *a ! read 3 a* ! read 4 a* ! (OK) consed.autoReportPrintLowConsensusQualityRegions: false bool ! (OK) consed.autoReportPrintSingleSubcloneRegions: false bool ! (OK) consed.autoReportPrintSingleStrandedRegions: false bool ! (OK) consed.autoReportPrintLinkingForwardReversePairs: false bool ! (OK) consed.autoReportPrintFilteredInconsistentForwardReversePairs: false bool ! (OK) consed.autoReportPrintAssemblySummary: false bool ! (OK) consed.showAllTracesDoNotShowTraceIfTheseTagsPresent: dataNeeded RWCString ! See consed.showAllTracesJustShowGoodTraces ! (OK) consed.nameOfFakeJoiningReadsIncludesAceFileName: false bool ! This is useful if the user is going to combine the reads ! from a number of different ace files together. ! (OK) consed.whenUserScrollsOffWindowMillisecondsBetweenScrolling: 250 int ! (OK) consed.whenUserScrollsOffWindowBasesToScrollEachTime: 15 int ! (OK) consed.compareContigsUseBandedRatherThanFullSmithWaterman: true bool ! (OK) consed.compareContigsBandSize: 50 int ! band size of banded Smith Waterman ! (OK) consed.assemblyViewShowFwdRevPairDepthsInRedIfOnlyThisMany: 1 int ! (OK) consed.assemblyViewShowSequenceMatches: true bool ! When false, do not show any sequence matches (repeats) ! at all in Assembly View. ! Some people like to start out this way since displaying sequence ! matches slows down scrolling. ! (OK) consed.assemblyViewOKToShowSequenceMatchesBetweenContigs: true bool ! (OK) consed.assemblyViewOKToShowSequenceMatchesWithinContigs: true bool ! (OK) consed.assemblyViewOKToShowDirectSequenceMatches: true bool ! This means in which neither copy must be complemented with respect ! to the way it is in the scaffold as created by Consed. ! (OK) consed.assemblyViewOKToShowInvertedSequenceMatches: true bool ! This means that exactly one copy must be complemented with respect ! to the way it is in the scaffold as created by Consed. ! (OK) consed.assemblyViewOnlyShowSequenceMatchesToAParticularRegion: false bool ! You must set consed.assemblyViewOnlyShowSequencematchesToThisContig ! consed.assemblyViewOnlyShowSequenceMatchesToThisRegionLeft ! consed.assemblyViewOnlyShowSequenceMatchesToThisRegionRight ! (OK) consed.assemblyViewOnlyShowSequenceMatchesToThisContig: RWCString ! You must make ! consed.assemblyViewOnlyShowSequenceMatchesToAParticularRegion: true ! (OK) consed.assemblyViewOnlyShowSequenceMatchesToThisRegionLeft: 0 int ! consed.assemblyViewOnlyShowSequenceMatchesToAParticularRegion: true ! (OK) consed.assemblyViewOnlyShowSequenceMatchesToThisRegionRight: 0 int ! consed.assemblyViewOnlyShowSequenceMatchesToAParticularRegion: true ! (OK) consed.assemblyViewOnlyShowSequenceMatchesToEndsOfContigs: false bool ! (OK) consed.assemblyViewOnlyShowSequenceMatchesToEndsOfContigsThisFar: 1000 int ! This many base pairs from the end of the contig. ! (OK) consed.defaultReadPrefix: * RWCString ! This is used as the character to prefix reads with when the ! read is in consed.readPrefixesFile and the prefix is not specified. ! (OK) consed.readPrefixesFile: readPrefixes.txt FileName ! This file should contain a list of reads that you would want to ! have prefixes in the Aligned Reads Window. Each line should ! have the following format: ! (read name) (prefix) (color) ! The prefix and color are optional. You can have a line like this: ! (read name) (prefix) ! or this: ! (read name) ! but not this: ! (read name) (color) ! If the color is not specified, the color will default to ! consed.colorReadPrefixes: blue ! If the prefix is not specified, it will default to ! (OK) consed.maxCharsDisplayedForReadPrefix: 1 int ! It is still ok to have long read prefixes in the file ! consed.readPrefixesFile but only this many characters ! will be displayed in the Aligned Reads window ! (OK) consed.autoFinishDoNotDoPCRIfThisManyAvailableGapSpanningTemplates: 2 int ! (OK) consed.autoFinishDoNotDoUnorientedPCRIfThisManyOrMoreUnorientedPCRReactions: 6 int ! \"unoriented\" pcr reactions means cases in which autofinish is suggesting ! a pcr reaction to span a gap, but it doesn't know whether the 2 contig ends ! really go together since there are not enough (or no)templates that span ! that gap ! (OK) consed.autoFinishDoNotDoOrientedPCRIfGapSizeLargerThanThis: 10000 int ! Gap size can be specified in user-defined contigEndPair tags in a ! gap_size: field ! If the gap size is greater than this number, do not do PCR. ! (OK) consed.autoFinishDoNotDoPCRIfEndIsExtendedByReads: false bool ! If this is true, and autofinish was able to walk off the end of a ! contig, do not do PCR with that end of the contig. ! ! (OK) consed.autoFinishMaxAcceptableErrorsPerMegabase: 0 int ! target error rate. This parameter used to be the one that stopped ! Autofinish from calling more reads. However, consider a BAC that is ! nearly perfect except for one region with 3 quality 10 bases in a ! row. In this case the global errors per megabase is very ! low--perhaps lower than 1 error per megabase. Despite this, most ! labs would like to do one more read to fix this problem. Thus we ! set this parameter to zero (to disable it) so Autofinish will use ! the parameter consed.autoFinishMinNumberOfErrorsFixedByAnExp to stop ! calling more reads--it is a local error rate. ! (OK) consed.autoFinishIfNotEnoughFwdRevPairsUseThisPerCentOfInsertSize: 90 int ! If a template has a forward but no reverse, when deciding whether to ! allow this template for a particular primer, we need to make an assumption ! of where is the end of the template. If the template comes from a library ! with insert size 1500, it would be reasonable to assume that the end of ! template will be 1500 bases from the forward read. But if this template ! has an insert that is shorter than average, the walk may walk into vector. ! To be conservative, we may want to assume that the insert is somewhat ! shorter than average. By default, we assume that it is 90% as large as ! the average. This parameter gives that percentage. This parameter ! is used both by Consed and Autofinish. ! (OK) consed.primersNumberOfBasesToBackUpToStartLooking: 50 int ! e.g., if this is 50 and you want a read at position 1000, primers ! will be searched before base 950 but not in the region 950 to 1000 ! This has no effect on Autofinish--just on interactively picking primers. ! (OK) consed.primersMakePCRPrimersThisManyBasesBackFromEndOfHighQualitySegment: 100 int ! When a PCR product is made, you want it to overlap by this many bases ! the high quality part of the existing consensus. Thus choose PCR ! primers this many bases back (or more) ! (OK) consed.primersOKToChoosePrimersInSingleSubcloneRegion: true bool ! (OK) consed.primersOKToChoosePrimersWhereHighQualityDiscrepancies: false bool ! (OK) consed.primersOKToChoosePrimersWhereUnalignedHighQualityRegion: false bool ! (OK) consed.autoFinishCallReversesToFlankGaps: true bool ! if there is a forward-reverse pair flanking a gap, print it out ! if there is not, suggest reverses to flank the gap ! (OK) consed.autoFinishAllowWholeCloneReads: false bool ! ok to call reads whose template for sequencing reaction is the ! entire clone (BAC or cosmid) ! (OK) consed.autoFinishAllowCustomPrimerSubcloneReads: true bool ! ok to call reads with custom primers and subclone template ! (OK) consed.autoFinishAllowResequencingReads: true bool ! This is just universal primer reads to be resequenced using ! dye terminator chemistry or special chemistry. (It does not ! mean resequencing a custom primer read.) ! (OK) consed.autoFinishAllowResequencingReadsOnlyForRunsAndStops: false bool ! This parameter only has any effect when ! consed.autoFinishAllowResequencingReads is set to true. In that ! case no resequencing reads will be suggested, unless it is to cross ! a run or stop and special chemistry is suggested. ! (OK) consed.autoFinishAllowDeNovoUniversalPrimerSubcloneReads: true bool ! Allows calling reverse when there is just a forward. ! Allows calling a forward when there is just a reverse. ! (OK) consed.autoFinishAllowMinilibraries: false bool ! Allows calling minilibraries (shatter libraries or transposon ! libraries) of subclone templates for closing gaps ! (OK) consed.autoFinishAllowPCR: true bool ! Allows calling PCR for closing gaps, but only as a last resort ! (OK) consed.autoFinishAllowUnorientedPCRReactions: true bool ! Allows calling PCR amongst contig-ends that have insufficient ! fwd/rev pair linkage to any other contig-end. Thus it suggests ! pcr amongst all such contig-ends. ! To allow this type of pcr, you must also make: ! consed.autoFinishAllowPCRForUnorientedContigEnds: true ! See also: ! consed.autoFinishDoNotDoUnorientedPCRIfThisManyOrMoreUnorientedPCRReactions: ! which gives you finer control over unoriented pcr. ! (OK) consed.autoFinishAllowResequencingAUniversalPrimerAutofinishRead: false bool ! if Autofinish suggests a de novo universal primer read, ! do not allow Autofinish to suggest a resequence of this read ! (OK) consed.autoFinishAlwaysCloseGapsUsingMinilibraries: false bool ! \"Minilibraries\" includes transposing a subclone template or ! making a shatter library from a subclone template ! (OK) consed.autoFinishMaximumFinishingReadLength: 2000 int ! Change this only if your finishing reads are typically shorter ! than your shotgun reads. Otherwise, leave it unrealistically long, ! and Autofinish will set its model read based on your existing ! shotgun reads. ! (OK) consed.autoFinishSuggestMinilibraryIfGapThisManyBasesOrLarger: 800 int ! (OK) consed.autoFinishSuggestSpecialChemistryForRunsAndStops: true bool ! Suggest special chemistry such as dGTP for reads that cross ! mononucleotide or dinucleotide repeats that cause reads to fail or ! stops (structure) that cause reads to fail and thus dye terminator ! reads won't work. ! (OK) consed.autoFinishSuggestThisManyMinilibrariesPerGap: 2 int ! (OK) consed.primersWindowSizeInLooking: 450 int ! e.g., if this is 300, with example above, primers will be searched ! from base 650 to 950. This has no effect on Autofinish--it is just ! used for interactive primer picking in Consed. ! (OK) consed.primersAssumeTemplatesAreDoubleStrandedUnlessSpecified: false bool ! you can put the template type in the phd file in a WR template item ! consed will have a list of these and know which are single and ! double stranded ! (OK) consed.alignedReadsWindowInitialCharsWide: 60 int ! initial width of the aligned reads window including the read name and ! the bases ! (OK) consed.alignedReadsWindowInitialCharsHigh: 20 int ! initial height of the aligned reads window area where the consensus ! and reads are ! (OK) consed.alignedReadsWindowMaxCharsForReadNames: 20 int ! how many columns are reserved for read names ! (OK) consed.alignedReadsWindowAutomaticallyExpandRoomForReadNames: true bool ! If true, expand and contract space for read names, but don't ! contract less than consed.alignedReadsWindowMaxCharsForReadNames. ! If false, then always use ! consed.alignedReadsWindowMaxCharsForReadNames ! for space reserved for read names. ! (OK) consed.autoFinishAllowResequencingReadsToExtendContigs: false bool ! if false, a resequencing read is not called to extend a contig--only ! custom primer reads and de novo universal primer reads are called ! for this purpose. ! (OK) consed.autoFinishCallHowManyReversesToFlankGaps: 2 int ! This has two purposes: 1) it specifies how many forward/reverse ! pairs should be present for Consed/Autofinish to be certain of the ! order/ orientation of two contigs. If there are this many fwd/rev ! pairs flanking a gap, Autofinish will print out the contig ends that ! flank the gap. 2) If consed.autoFinishCallReversesToFlankGaps is ! set to true, and there are less than this many fwd/rev pairs ! flanking a gap, Autofinish will suggest additional reverses until ! there are this many. ! (OK) consed.autoFinishCloseGaps: true bool ! this allows you to turn off choosing reads to close gaps ! (OK) consed.autoFinishContinueEvenThoughReadInfoDoesNotMakeSense: false bool ! this allows you to override the checks that autofinish makes on the ! read info, such as checking there are not more than 5 or so reads ! from the same subclone template ! (OK) consed.autoFinishCostOfResequencingUniversalPrimerSubcloneReaction: 20.0 double ! compares universal primer subclone reaction, custom primer subclone ! reaction, and custom primer clone reaction to decide which to favor ! (OK) consed.autoFinishCostOfCustomPrimerSubcloneReaction: 60.0 double ! see above ! (OK) consed.autoFinishCostOfCustomPrimerCloneReaction: 80.0 double ! see above ! (OK) consed.autoFinishCostOfDeNovoUniversalPrimerSubcloneReaction: 60.0 double ! cost of reverse where there is only a forward or cost of forward ! when there is only a reverse ! (OK) consed.autoFinishCostOfMinilibrary: 500.0 double ! cost of making a minilibrary (transposon library or shatter library) ! from a subclone template ! (OK) consed.autoFinishCoverSingleSubcloneRegions: true bool ! this allows you to turn off choosing reads to cover single subclone regions ! (OK) consed.autoFinishCoverLowConsensusQualityRegions: true bool ! this allows you to turn off choosing reads to cover low consensus ! quality regions ! (OK) consed.autoFinishDebugUniversalPrimerReadsFile: gordon_debug.txt FileName ! for debugging Autofinish ! put a file with this name in the same directory as the ace file ! format: ! fcalld09 fwd ! fgj74f01 rev ! (template name) (fwd or rev) ! (OK) consed.autoFinishDebugCustomPrimerReadsFile: debug_custom.txt FileName ! for debugging Autofinish ! put a file with this name in the same directory as the ace file ! format: ! cgggacctgg ! (primer in 5' to 3' orientation) ! (OK) consed.autoFinishDoNotAllowSubcloneCustomPrimerReadsCloserThanThisManyBases: 200 int ! see consed.autoFinishDoNotAllowSubcloneCustomPrimerReadsCloseTogether ! (OK) consed.autoFinishDoNotAllowWholeCloneCustomPrimerReadsCloserThanThisManyBases: 300 int ! see consed.autoFinishDoNotAllowWholeCloneCustomPrimerReadsCloseTogether ! (OK) consed.autoFinishDoNotFinishWhereTheseTagsAre: doNotFinish editable RWCString ! list of tag types separated by spaces. E.g., ! doNotFinish repeat ! tells autofinish that you are not interested in finishing in this region ! (OK) consed.autoFinishDoNotExtendContigsWhereTheseTagsAre: doNotFinish RWCString ! list of tag types separated by spaces. E.g., ! doNotFinish repeat ! tells autofinish that you do not want to extend the contig near this ! tag. If you do not want this feature, just leave the list empty. ! (OK) consed.autoFinishDoNotExtendContigsIfTagsAreThisCloseToContigEnd: 50 int ! Uses the list from consed.autoFinishDoNotExtendContigsWhereTheseTagsAre ! and checks if any of these tags are within this many bases of the end of ! the contig. If they are, does not extend the contig. ! (OK) consed.dumpContigOrderAndOrientationInfoToThisFile: FileName ! In the case of Consed (not autofinish or autoPCRAmplify), send the ! output to this file rather than stderr. If this name is blank, ! continue (in case of consed), to send output to stderr. ! (OK) consed.autoFinishDumpTemplates: false bool ! for debugging, this allows you to dump all information about the ! templates--insert locations ! (OK) consed.autoFinishExcludeContigIfOnlyThisManyReadsOrLess: 10 int ! (OK) consed.autoFinishExcludeContigIfDepthOfCoverageGreaterThanThis: 50.0 double ! To exclude contigs that are probably E. coli contamination ! \"depth of coverage\" is defined here to mean the sum of the read ! lengths (including low quality ends) divided by the contig length. ! (OK) consed.autoFinishExcludeContigIfThisManyBasesOrLess: 1000 int ! consed.autoFinishExcludeContigIfTooShort must be set to true for ! this to have any effect ! (OK) consed.autoFinishHowManyTemplatesYouIntendToUseForCustomPrimerSubcloneReactions: 3 int ! this tells autofinish which templates you are planning on using ! which is necessary to figure out which regions will still be single ! subclone regions ! (OK) consed.primersMinNumberOfTemplatesForPrimers: 1 int ! if there are fewer templates than this, the primer is rejected // Pat wanted this 70 on May 5, 2000 to allow for 20 bases of poor // quality at beginning of read and then 50 bases for phrap to // assemble together consed.autoFinishMinBaseOverlapBetweenAReadAndHighQualitySegmentOfConsensus: 70 int ! when extending the consensus, a read that is too far from the ! consensus will not be assembled by phrap with this contig and thus ! will not be useful for extending the consensus. This gives the ! minimum overlap of a read with the high quality segment of the ! consensus. As reads are picked, then additional reads may be picked ! further out. ! (OK) consed.autoFinishNumberOfVectorBasesAtBeginningOfAUniveralPrimerRead: 40 int ! used to figure out where the beginning of a reverse will be. Not ! important to be accurate because the insert size is so uncertain ! (OK) consed.autoFinishCDNANotGenomic: false bool ! If this is set to true, the whole clone is assumed to be cDNA and, ! rather than the normal method of detecting the end of the clone, ! Autofinish detects the end of the cDNA as follows: ! the user is expected to add whole read items of type 'template', ! with 'type: univ fwd' for the 5' end and 'type: univ rev' for the 3' ! end of the cDNA. ! (OK) consed.autoFinishConfidenceThatReadWillCoverSingleSubcloneRegion: 90 int ! Autofinish computes the per cent of existing reads are aligned at ! each base position. Typically, this number starts at around 0% at ! base position 1, rises to close to 100% at around base position 300, ! and then drops again to 0% at base position 800 or so. This number ! specifies how high the number must be for Autofinish to consider an ! Autofinish read to cover a single subclone region. ! (OK) consed.autoFinishPrintForwardOrReverseStrandWhenPrintingSubcloneTemplatesForCustomPrimerReads: true bool ! If this is true, then custom primer reads are printed out like this: ! tccagaaaactaattcaaaataatg,56,standard.2,->,2413,2413,3681,Contig1,9,djs74_690 (fwd),10,djs74_1803 (fwd),11,djs74_1861 (fwd) ! If this is false, then custom primer reads are printed out like this: ! tccagaaaactaattcaaaataatg,56,standard.2,->,2413,2413,3681,Contig1,9,djs74_690,10,djs74_1803,11,djs74_1861 ! The difference is the (fwd) or (rev) that indicates which strand of ! the subclone template is to be used. This is particularly important if ! you use M13 and thus must make the reverse strand. ! (OK) consed.autoFinishPrintMinilibrariesSummaryFile: false bool ! If this is true, Autofinish will print a file with name ! xxx.minilibraries just as it prints one as xxx.univReverses and ! xxx.univForwards ! (OK) consed.autoFinishNearGapsSuggestEachMissingReadOfReadPairs: true bool ! This is set to true to increase the chance of closing a gap. For ! every subclone template that has just one universal primer read ! (either just a forward or just a reverse) that might protrude off ! the end of the contig, Autofinish suggests the universal primer read ! off the opposite end of the subclone template. ! If this parameter is set false, then ! Autofinish may still choose some of these reads, but it won't ! necessarily choose them all. ! (OK) consed.autoFinishDoNotIgnoreLCQIfThisManyBasesFromEndOfContigForLCQTagger: 300 int ! Do not ignore low consensus quality bases if they are this many ! bases from the end of the contig. ! (OK) consed.checkIfTooManyWalks: true bool ! this just checks if the number of walks, pcr ends, and unknown reads ! exceeds 20% of the total number of reads. If this is exceeded, then ! a warning message is given. Typically, such a warning indicates ! that you have incorrectly customized determineReadTypes.perl ! (OK) consed.numberOfColumnsBeforeReadNameInAlignedReadsWindow: 1 int ! this is for displaying information about the whole read items, ! both from PHD files and from a file consed.compareContigsAlignsThisManyBasesMax: 2000 int ! (OK) consed.compressedChromatExtension: .gz RWCString ! (OK) consed.dimLowQualityEndsOfReads: false bool ! ! (OK) // phil 980713 requested that the default be to not dim // low quality ends of reads and to dim the unaligned ends // of reads consed.dimUnalignedEndsOfReads: true bool ! (OK) consed.fakeReadsSpecifiedByFilenameExtension: true bool ! if this is true, then reads that end with .a[0-9]* or .c[0-9]* will ! be considered fake reads. Otherwise, fake reads will be indicated ! by a WR item in the PHD file. ! (OK) consed.fullPathnameOfAddReads2ConsedScript: $CONSED_HOME/bin/addReads2Consed.perl FileName ! (OK) consed.fullPathnameOfFixContigEndScript: $CONSED_HOME/bin/fixContigEnd.perl FileName ! (OK) consed.fixContigEndsCleanUpTemporaryFiles: true bool ! -fixContigEnds leaves behind zillions of temporary files from ! phrapping. Delete these (except for debugging). ! (OK) consed.fixContigEndsMinSmithWatermanScoreToMakeJoin: 30 int ! when making the join, if the smith-waterman score is less ! than this, do not make the join and leave the contig-end as is ! (NO) consed.fixContigEndsMinNumberOfReadsInContig: 5 int ! only fix contigs that have this number of reads or more ! (YES) consed.fullPathnameOfCrossMatch: $CONSED_HOME/bin/cross_match FileName ! (OK) consed.fullPathnameOfPhred: $CONSED_HOME/bin/phred FileName ! (OK) consed.fullPathnameOfMiniassemblyScript: $CONSED_HOME/bin/phredPhrap FileName ! If you are up-to-date with phredPhrap, this script serves both ! the purpose of assemblying the entire project, as well as making ! miniassemblies. The difference is whether phredPhrap has the ! -include_chromats option. ! (OK) consed.gunzipFullPath: /bin/gunzip RWCString ! (OK) consed.fullPathnameOfFilter454ReadsScript: $CONSED_HOME/bin/filter454Reads.perl FileName ! Runs crossmatch between the unpaired reads and puc19 to eliminate those ! reads contaminated with puc19 ! (OK) consed.filter454ReadsAgainstThis: $CONSED_HOME/lib/screenLibs/filter454Reads.fa FileName ! used by consed.fullPathnameOfFilter454ReadsAgainstVectorScript ! (OK) consed.454LinkerSequences: $CONSED_HOME/lib/screenLibs/sffLinkers.fa FileName ! the linker sequence for paired-end 454 reads used in ! sff2PhdBall ! (OK) consed.hideSomeTagTypesAtStartup: false bool ! (OK) consed.maximumNumberOfTracesShown: 4 int ! (OK) consed.navigateAutomaticTracePopup: false bool ! (OK) consed.navigateAutomaticAllTracesPopup: false bool ! (OK) consed.primersMinimumLengthOfAPrimer: 15 int ! (OK) consed.primersMaximumLengthOfAPrimer: 25 int ! (OK) consed.primersMinimumLengthOfAPrimerForPCR: 18 int ! (OK) consed.primersMaximumLengthOfAPrimerForPCR: 30 int ! (OK) consed.primersMaxMeltingTempDifferenceForPCR: 3.0 double ! how large can the difference of melting temperatures be between ! two primers of a PCR primer pair ! (OK) consed.primersMaxPCRPrimerPairsToDisplay: 100000 int ! there is a limit here, because there could possibly be millions ! (OK) consed.primersCheckJustSomePCRPrimerPairsRatherThanAll: true bool ! If there are 1000 1st primers, and 1000 2nd primers, that gives ! a million pairs for Consed to check, which takes a long time. So ! instead, just check some of the pairs ! (OK) consed.primersNumberOfTemplatesToDisplayInFront: 2 int ! this shows the number of templates to show in the interactive primer ! picking window ! (OK) consed.primersMaxLengthOfMononucleotideRepeat: 4 int ! (OK) consed.primersBadLibrariesFile: badLibraries.txt FileName ! file of libraries, one per line ! If any template is from any one of these libraries, then ! consed/autofinish will not use this template for walking or ! suggesting any universal primer reads ! (OK) consed.primersLibrariesInfoFile: librariesInfo.txt FileName ! file of libraries, with one entry for each library of the following ! format: ! LIB{ ! name: library1 ! avgInsertSize: 3000 ! maxInsertSize: 5000 ! stranded: single ! cost: 600.0 ! } ! (OK) consed.primersBadTemplatesFile: badTemplates.txt FileName ! file of templates that you've tried, don't work, and you don't want to try ! again ! (OK) consed.primersChooseTemplatesByPositionInsteadOfQuality: true bool ! Templates for subclone custom primer walks can be chosen either on ! the basis of the quality of the template (as determined by the quality ! of existing reads from that template) or by the location of the end of ! the template. If this parameter is false, templates will be chosen ! based solely on quality. If this parameter is true, then templates ! with forward/reverse pairs will be picked first, followed by templates ! that have the beginning of the insert closest to the primer. ! (OK) consed.primersWhenChoosingATemplateMinPotentialReadLength: 350 int ! when choosing templates for a custom primer, only choose a template ! if the read can be chosen at least this long ! (OK) consed.primersWindowSizeInLookingForPCR: 2000 int ! will look this many bases back from the pointer when looking for a PCR ! primer. Used both interactively and for Autofinish (see ! getUnpaddedRangeForMakingPCRPrimers ) ! (OK) consed.qualityThresholdForFindingHighQualityDiscrepancies: 40 int ! high quality discrepancies have this quality or higher ! (OK) consed.qualityThresholdForNavigateByDepthOfCoverage: 10 int ! for high depth of coverage, this is the minimum quality ! see consed.navigateByHighDepthOfCoverageNotLow ! (OK) consed.navigateByHighDepthOfCoverageNotLow: true bool ! see consed.qualityThresholdForNavigateByDepthOfCoverage: ! (OK) consed.MinDepthForNavigateByDepthOfCoverage: 10 int ! see consed.qualityThresholdForNavigateByDepthOfCoverage: ! (OK) consed.defaultVectorPathnameForRestrictionFragments: $CONSED_HOME/lib/screenLibs/singleVectorForRestrictionDigest.fasta FileName ! If you want to have the vector cut with the restriction ! enzymes, put the vector sequence in a file in fasta format ! and put a pathname to it here. ! (OK) consed.fileOfAdditionalRestrictionEnzymes: FileName ! If you want a restriction enzyme that is not in the huge list ! that comes with Consed, you can put additional enzymes in a file ! and put the full pathname of that file here. The file must be in ! the form: ! AatI AGGCCT ! where AatI is the name of the enzyme and AGGCCT is the recognized ! sequence. Do not include the cut site or any other information. ! There must be a single space separating them. ! (OK) consed.commonRestrictionEnzymes: BglII EcoRV NsiI HindIII BamHI XhoI PstI RWCString ! a space-separated list of enzymes. Make sure they match precisely ! those that are either defaults or in the file indicated by ! consed.fileOfAdditionalRestrictionEnzymes ! (OK) consed.defaultSelectedRestrictionEnzymes: EcoRV HindIII RWCString ! a space-separated list of enzymes that will initially be ! selected when the user pops open the list of restriction enzymes. ! Currently these must be from among the consed.commonRestrictionEnzymes ! (OK) consed.restrictionEnzymesActualFragmentsFile: fragSizes.txt FileName ! format like this: ! >EcoRV ! 2385 ! 2489 ! -1 ! >XhoIII ! 259 ! 3843 ! -1 ! (OK) consed.restrictionDigestInitialWindowSizeInTextRows: 45 int ! (OK) consed.restrictionDigestDoNoShowAreaOfFragmentsOverThisSize: 50000 int ! In the picture of the real and in-silico ! (OK) consed.showReadsAlphabetically: false bool ! (OK) consed.showReadsInAlignedReadsWindowOrderedByFile: false bool ! There are now 3 different ways to sort the reads in the Aligned ! Reads Window (top to bottom): ! 1) alphabetically in which case you should set: ! consed.showReadsAlphabetically: true ! consed.showReadsInAlignedReadsWindowOrderedByFile: false ! 2) by the left end of the reads in which case you should set: ! consed.showReadsAlphabetically: false ! consed.showReadsInAlignedReadsWindowOrderedByFile: false ! 3) by a file that specifies the order of the reads in which case you ! should set: ! consed.showReadsAlphabetically: false ! consed.showReadsInAlignedReadsWindowOrderedByFile: true ! It is an error to set: ! consed.showReadsAlphabetically: true ! consed.showReadsInAlignedReadsWindowOrderedByFile: true ! (OK) consed.showReadsInAlignedReadsWindowOrderedByThisFile: readOrder.txt FileName ! This file has one read name per line. Wildcards ('*') are allowed. ! E.g., ! ABX* ! myFavoriteRead.scf ! *.abi ! This means that all reads that start with ABX* will come first, ! followed by the single read myFavoriteRead.scf and then reads that end ! with .abi A read that doesn't meet any of these criteria (e.g., ! rs10469282 ) comes last. ! (OK) !consed.showReadsSortedByQualityValuesAtCursor: true !bool ! deprecated ! Note that currently this only applies when the cursor is set ! on the consensus position. When scrolling, the reads are ! sorted according to consed.showReadsAlphabetically and ! consed.showReadsInAlignedReadsWindowOrderedByFile ! (OK) consed.showReadsAtCursorSortedHow: quality RWCString ! Note that currently this only applies when the cursor is set ! on the consensus position. When scrolling, the reads are ! sorted according to consed.showReadsAlphabetically and ! consed.showReadsInAlignedReadsWindowOrderedByFile ! use the following values: quality, base, none ! (OK) consed.showABIBasesInTraceWindow: false bool ! (OK) consed.tracesWindowInitialPixelHeight: 50 int ! (OK) consed.assemblyViewWindowInitialPixelHeight: 500 int ! (OK) consed.assemblyViewFileOfTemplatesToNotShow: doNotShowInAssemblyView.fof FileName ! (OK) consed.assemblyViewCrossMatchMinmatch: 30 int ! value of -minmatch to be passed to crossmatch ! (OK) consed.assemblyViewCrossMatchMinscore: 60 int ! value of -minscore to be passed to crossmatch ! (OK) consed.assemblyViewFindSequenceMatchesForConsedScript: $CONSED_HOME/bin/findSequenceMatchesForConsed.perl FileName ! script that generates the file that is used by Assembly View to ! show sequence matches ! (OK) consed.assemblyViewCrossmatchMinmatch: 50 int ! default value of -minmatch for running crossmatch with ! findSequenceMatchesForConsed.perl ! (OK) consed.assemblyViewCrossmatchMinscore: 50 int ! default value of -minscore for running crossmatch with ! findSequenceMatchesForConsed.perl ! (OK) consed.assemblyViewSequenceMatchesMinimumSimilarity: 90 int ! only show sequence matches if their simlarity is at least this ! value. This can be changed by the user within consed/assembly view/ ! by clicking on "What to show/Sequence Matches" ! (OK) consed.tracesWindowInitialPixelWidth: 800 int ! (OK) consed.assemblyViewWindowInitialPixelWidth: 800 int ! (OK) consed.automaticallyScaleTraces: true bool ! (OK) consed.automaticallyScaleTracesSamplePeakHeightFractionOfWindowHeight: 0.99 double ! (OK) consed.automaticallyScaleTracesSamplePeakPercentile: 100 int ! (OK) consed.verticalTraceMagnification: 30 int ! (OK) consed.userDefinedKeys: 14 15 RWCString ! make a space-separated list of the decimal ASCII values of the keys ! 14 means control-N, 15 means control-O ! (OK) consed.programsForUserDefinedKeys: /bin/echo /bin/echo RWCString ! a space-separated list of the full pathnames of the commands to run ! This goes with consed.userDefinedKeys ! (OK) consed.argumentsToPassToUserDefinedPrograms: argument_for_first_key argument_for_second_key RWCString ! a space-separated list of the arguments to pass to the user-defined programs ! This goes with consed.userDefinedKeys ! (OK) consed.tagsToApplyWithUserDefinedKeys: none polymorphismConfirmed RWCString ! a space-separate list of the tag types to apply when the user ! presses a user-defined key. If a key is to have no associated tag, ! then enter "none" for that key. ! This goes with consed.userDefinedKeys ! (OK) consed.snpGenomeUseInsertionPolymorphisms: true bool ! used with consed -snpGenome ! (OK) consed.listOfTagTypesToHide: matchElsewhereHighQual matchElsewhereLowQual RWCString ! (OK) consed.listOfOptionalWordsToSaveInListOfReadNames: forward reverse ET BigDye customOligo SeqEx FS dyePrimer dyeTerminator doubleStranded singleStranded RWCString ! (OK) consed.extendConsensusWithHighQuality: false bool ! When using "change consensus" to extend the consensus, make the ! read edited high quality. This will cause phrap, the next time ! the project is assembled, to similarly extend the consensus. If ! this is set to false, then do not change the quality of the read and ! extend the consensus with the original read qualities. ! (OK) consed.fastStartup: true bool ! If you have used catPhdFiles.perl to create a huge file with all the ! xxx.phd.1 files, and you have enough memory on your computer, then ! you can startup up consed up to 7 times faster ! (OK) consed.fastStartupFile: phd.ball FileName ! If you have used catPhdFiles.perl to create a huge file with all the ! xxx.phd.1 files, and you have enough memory on your computer, then ! you can startup up consed up to 7 times faster. This file gives ! the name of the huge file. ! (OK) consed.alwaysRunProgramToGetChromats: false RWCString ! This allows consed to get chromats out of a database, or do some ! other pre-processing of a chromat before reading it. If set to true, ! consed does not look in ../chromat_dir at all for the chromat, but ! rather runs the program listed in consed.programToRunToGetChromats ! with argument name-of-read and then reads the chromat out of ! consed.uncompressedChromatDirectory and then later deletes the ! chromat from consed.uncompressedChromatDirectory ! If set to false, it never does this. If set to "last", it does ! this as a last resort. ! (OK) consed.programToRunToGetChromats: /usr/local/bin/myFavoriteProgram FileName ! Set this to the program or script that you want to use to ! get a chromat and put it into /tmp (or whatever you set ! consed.uncompressedChromatDirectory to) ! (OK) consed.programToRunToGetChromatsOf454Reads: $CONSED_HOME/bin/sff2scf FileName ! This will be run on 454 reads if the read is not found in ! chromat_dir. If you don't want this to happen, you can make ! this null. ! (OK) consed.createFakeChromatsForSolexaReads: true bool ! (OK) consed.autoFinishUseLongModelReadRatherThanShort: false bool ! When calculating the distribution of quality values at high read ! positions, should Autofinish assume that the reads that were this ! long and longer are representative of finishing reads, or should it ! assume that some finishing will not make it out this far in roughly ! the same proportion as the existing reads. ! (OK) consed.askAgainIfWantToQuitConsedIfThisManyReads: 500000 int ! If you have to wait a long time for consed to come up, don't ! quit out of consed by mistake. ! (OK) consed.printWindowInstructions: Make sure that the window you want to print is unobscured. Then click \"Yes\" to dismiss this box. Then click on the window you want to print. You will hear a beep immediately, then another beep a little later. Then the copy of the window should come off the printer specified by your environment variable LPDEST. RWCString ! (OK) consed.allowMultipleSearchForStringWindows: false bool ! If this is false, and there is already a SearchForString Window up, ! and the user clicks on SearchForString, it will be brought to the ! front, rather than another one being created. ! (OK) consed.autoPCRAmplifyFalseProductsOKIfLargerThanThis: 3000 int ! If a pcr primer pair matches somewhere else and creates a product ! larger than this, the pcr primer pair will still be acceptable ! since the product will not easily form in the cycle time. ! (OK) consed.autoPCRAmplifyMakePrimerOutOfFirstRegion: false bool ! I don't expect people will use this. It allows you to amplify a ! region using autoPCRAmplify not by allowing Consed to choose each ! primer (the normal case) but rather by fixing the first primer to be ! the first area bordering the region. I added this to allow ! non-specific priming to the transplice leader. ! (OK) consed.autoPCRAmplifyMaybeRejectPrimerIfThisCloseToDesiredProduct: 5000 int ! ---> ---> ! false true match ! In such a case, the primer pair will be rejected if the false is ! within 5000 bases of true, even if false is a false match of the ! other primer. ! ! <--- ---> ! false true match ! In this case, the primer pair will not be eliminated. ! (OK) consed.addNewReadsRecalculateConsensusQuality: false bool ! When running consed by ! consed -ace old_ace.ace -addReads fileOfPhdFiles.txt -newAceFilename new_ace.ace ! consensus quality is recalculated ! This also applies to add454Reads.perl and addSolexaReads.perl ! (OK) consed.addNewReadsPutReadIntoItsOwnContig: ifUnaligned RWCString ! choices are: ! "always" (just put each read into its own contig) ! "ifUnaligned" (put read into a contig if it aligns against the ! consensus, otherwise put it into its own contig) ! "never" (put read into a contig if it aligns against the consensus; ! otherwise do not put it into the assembly) ! (OK) consed.addNewReadsCheckThatCrossMatchRunCorrectly: true bool ! addReads2Consed.perl changed in March 2008 to have -discrep_lists ! instead of -alignments. Check that user is using the new ! parameters ! (OK) consed.assemblyViewNumberOfRowsOfTags: 4 int ! (OK) consed.warnUserWhenTryingToEditAllReads: true bool ! in the Aligned Reads Window, the user may change all reads at once ! to a particular base at a particular position. This is dangerous ! and the user is warned. This resource allows the user to suppress ! this warning. ! (OK) consed.maybeXKEYSYMDBPath: /usr/share/X11/XKeysymDB FileName ! Fixes a problem in X on some versions of linux giving pages of the ! following errors: ! Warning: translation table syntax error: Unknown keysym name: osfActivate ! (OK) consed.maybeXKEYSYMDBPath2: /usr/X11R6/lib/X11/XKeysymDB FileName ! Fixes a problem in X on some versions of linux giving pages of the ! following errors: ! Warning: translation table syntax error: Unknown keysym name: osfActivate ! (OK) consed.amountToMoveWithBigLeftAndRightArrows: 10 int ! allows user to move on a read in the Aligned Reads Window ! by more than 1 base at a time ! (OK) consed.navigateByHighlyDiscrepantPositionsMinDiscrepantReads: 2 int ! ignores low quality reads ! (OK) consed.navigateByHighlyDiscrepantPositionsMaxDepthOfCoverage: 100000 int ! (OK) consed.navigateByHighlyDiscrepantPositionsIgnoreBasesBelowThisQuality: 20 int ! (OK) consed.navigateByHighlyDiscrepantPositionsJustListIndels: false bool ! (OK) consed.navigateByHighlyDiscrepantPositionsIgnoreOtherReadsStartingAtSameLocation: false bool ! If there are, for example, 3 reads that all start at the same ! location, use only the first and ignore the second and third ! (OK) consed.navigateByHighlyDiscrepantPositionsIgnoreIfListedBasesInConsensus: false bool ! Do not report this position if there is one of the bases in the consensus ! listed in ! consed.navigateByHighlyDiscrepantPositionsIgnoreIfTheseBasesInConsensus ! (OK) consed.navigateByHighlyDiscrepantPositionsIgnoreIfTheseBasesInConsensus: xn RWCString ! Do not report this position if there is one of these bases in the ! consensus and if ! consed.navigateByHighlyDiscrepantPositionsIgnoreIfListedBasesInConsensus: ! is set to true ! (OK) consed.phdBallDirectory: ../phdball_dir FileName ! phd balls are assumed to be in here. This is typically where consed ! starts, but could be relative to that, such as ../phdball_dir ! (OK) consed.newAceFileFOF: newAceFile.fof FileName ! if consed needs to write a new ace file, the name of that is written ! to this file ! (OK) consed.navigateByHighOrLowDepthCoalesceRegionsIfThisClose: 50 int ! for navigate by high or low depth of coverage ! (OK) consed.removeReadsDeleteNotJustPutInOwnContig: true bool ! used for consed -removeReads and consed -removeContigs ! (OK) consed.paired454LeftReadExtension: _left RWCString ! (OK) consed.paired454RightReadExtension: _right RWCString ! (OK) consed.snpGenome1MSnps: snp1M.txt FileName ! file for development of snpGenome ! (OK) consed.diffChromosomesExcludeDeletions: false bool ! for testing snpGenome moving deletions ! (OK) consed.snpGenomeFilterByWeight: true bool ! if true, only considers polymorphisms with soWeight == "1" ! (OK) consed.wantReadsUpToThisFarFromSnps: 50 int ! for phaster2PhdBall (phaster2Ace.perl ) to take reads, even if they don't overlap the ! snp, that are this far away from the snp ! (OK) consed.phaster2PhdBallSaveWhichMate: both RWCString ! for phaster2PhdBall (phaster2Ace.perl) to determine whether ! the function of just saving the reads that intersect the snp are ! saved, or whether both mates of a read pair are saved if either one ! intersects the snp location and has one of the desired alleles ! alternative: unmapped which says that just the unmapped read is ! saved ! (OK) consed.phaster2PhdBallSaveInPhasterFormat: false bool ! for phaster2PhdBall::maybeSaveBothReads to save the read in ! phaster format rather than in phd format. This only applies ! if consed.phaster2PhdBallSaveBothMates: is set to true ! the phaster lines will be set to the file specified by ! -phdBall on the command line ! (OK ) consed.phaster2PhdBallCalculateNewLocationsFile: false bool ! for phaster2PhdBall. Calculates depth of coverage and ! makes new locations that have depth of coverage consed.phdBall2FastaIgnoreLowQualityReads: false bool ! for consed -phdBall2Fasta ! if a read has mean quality below a threshold, do not ! write it to the fasta file ! (OK) consed.phdBall2FastaLowestAverageQuality: 25 int ! for consed -phdBall2Fasta ! if read has mean quality below this, ignore it ! (OK) consed.nextPhredPipelineControlFile: control-file.txt FileName ! (OK) consed.nextPhredPipelineTiffPerlScript: bin/run_tiff2intens_1_tile.perl FileName ! (OK) consed.nextPhredPipelinePhasterPerlScript: bin/run_phaster_1_tile.perl FileName ! (OK) consed.nextPhredPipelineVersion: 100625 RWCString ! (OK) consed.nextPhredPipelineMainDirectory: /et/grc/vol3/np_testing/pipeline RWCString ! (OK) ! ! ! ! parameters in the (NO) category ! ! consed.maxNumberOfReadsPerPhdBall: 1000000 int ! This is important since cross_match slows down on fasta files of ! over a few million reads ! (NO) consed.userWantsToSaveToThisAceFile: FileName ! (NO) consed.autoFinishEmulate9_66Behavior: false bool ! Picks univ primer reads and walks in the same phase. This results ! in poor redundancy of universal primer reads, may pick custom primer ! reads over universal primer reads, but may pick fewer ! reads overall. ! (NO) consed.primersPCRPrimersGroupedIntoWindowOfThisManyBases: 200 int ! to speed up PCR primer picking and to reduce the number of ! PCR primer pairs, group primers into windows of this size ! and then just compare window against window ! (NO) consed.primersLookForThisManyPCRPrimerPairsPerPairOfGroups: 2 int ! to speed up PCR primer picking and to reduce the number of PCr ! primer pairs, group primers into windows and then just accept ! this many primer pairs from a pair of groups ! (NO) consed.autoFinishStandardDeviationsFromMeanFromGapToLookForTemplatesForSuggestingEachMissingReadOfReadPairs: -1.0 double ! Only applies when consed.autoFinishNearGapsSuggestEachMissingReadOfReadPairs: ! is set to true. If m is the mean insert size and d is the standard ! deviation and this parameter is p, then consider all templates ! within a distance m + p*d from the gap. ! (NO) consed.autoFinishCheckThatReadsFromTheSameTemplateAreConsistent: true bool ! I strongly advise keeping this true. If you change it to false, you ! are on your own. If the forward and reverse universal primer reads ! look like this: <--- ---->, how is autofinish going ! to even know where the template is, huh? Leave it true! ! (NO) consed.autoFinishDoNotAllowSubcloneCustomPrimerReadsCloseTogether: true bool ! at higher redundancy, autofinish may pick custom primer reactions ! that are only a few bases apart on the same strand. This parameter, ! along with ! consed.autoFinishDoNotAllowSubcloneCustomPrimerReadsCloserThanThisManyBases, ! says how far apart they can be ! (NO) consed.autoFinishDoNotAllowWholeCloneCustomPrimerReadsCloseTogether: true bool ! Even at redundancy 1, Autofinish may pick whole clone reads just ! a few bases apart. This prevents it. ! (NO) consed.autoFinishMinilibrariesPreferTemplateIfSizeThisManyStdDevsFromMean: 2.0 double ! If a template is more than this many standard deviations from the ! mean, try to avoid using it, unless there is nothing else. ! Rationale: there is something wrong with this template--an insertion ! or deletion. ! (NO) consed.autoFinishMinNumberOfForwardReversePairsInLibraryToCalculateAverageInsertSize: 5 int ! If there are at least this many fwd/rev pairs in a library, then ! the mean and standard deviation are used for sizing other templates in ! the same library. If there are fewer than this, then the default size ! specified in the librariesInfo.txt file is used. ! (NO) consed.autoFinishIfEnoughFwdRevPairsUseThisManyStdDevBelowMeanForInsertSize: 0.2 double ! If you are interested in walking on a template that does not have a ! forward/reverse pair, then the precise insert size is uncertain. If ! this template comes from a library that has lots of templates with ! forward/reverse pairs, then the mean and standard deviation of the ! insert sizes from this library is known. For the template in ! question, we could just use the mean of this library (this parameter = ! 0.0), but we could be conservative and assume the insert size is ! somewhat less. This parameter tells how much less. ! (NO) consed.autoFinishNewCustomPrimerReadThisFarFromOldCustomPrimerRead: 50 int ! this tells autofinish when it wants to make a new custom primer ! read, how far this read must be from any previous custom primer ! reads on the same strand ! (NO) consed.autoFinishMinNumberOfSingleSubcloneBasesFixedByAnExp: 1 int ! if an experiment will only fix less than this number of single ! subclone bases, don't do it even if the total number of single ! subclone bases in the contig is too high ! (NO) consed.autoFinishNumberOfBasesBetweenContigsAssumed: 1000 int ! gap size--each base in the gap counts as 1 error so autofinish tries ! to extend into gaps ! (NO) consed.autoFinishPotentialHighQualityPartOfReadStart: 80 int // Phil and Kerrie both suggested upping this from 50 // on March 25, 1999 ! nReadUnpaddedConsPosStart + nAutoFinishPotentialHighQualityPartOfReadStart_ ! == nReadUnpaddedConsPosStartOfPotentialHighQuality ! this is used to evaluate the quality of templates ! this no longer has much effect on the reads autofinish chooses ! (NO) consed.autoFinishPotentialHighQualityPartOfReadEnd: 300 int ! nReadUnpaddedConsPosStart + nAutoFinishPotentialHighQualityPartOfReadEnd_ ! == nReadUnpaddedConsPosEndOfPotentialHighQuality ! this is used to evaluate the quality of templates ! this no longer has much effect on the reads autofinish chooses ! (NO) consed.autoFinishPrintCustomNavigationFileForChosenReads: true bool ! If this is true, then autofinish will print a file of the chosen reads ! in the format for consed to navigate (prev and next) to each ! location of the proposed new reads ! (NO) consed.autoFinishReversesForFlankingGapsTemplateMustProtrudeFromContigThisMuch: 100 int ! Normal case: ! --------------------------- (consensus) ! ----------- template1 ! ----------- template2 ! ----------- template3 ! Then you probably would want to use template3 since a reverse is ! most likely to go in the other contig rather than go into gap. ! But suppose that template2 and template3 don't exist. Would you ! want to use template1? This parameter tells Autofinish whether you ! would want to use it, or pick no reverse at all. ! (NO) consed.autoFinishTagOligosWhenDoExperiments: true bool ! when autofinish is run with -doExperiments, tags the oligos ! it chooses ! (NO) consed.countPads: false bool ! (NO) consed.debugging: 0 int ! for consed development use ! (NO) consed.debugging2: 0 int ! for consed development use ! (NO) consed.debugging3: 0 int ! for consed development use ! (NO) consed.debuggingString: joseph RWCString ! for consed development use ! (NO) consed.ignoreHighQualityDiscrepanciesThisManyBasesFromEndOfAlignedRegion: 5 int // Phil specified this (changed from 10) on 6/30/98 consed.ignoreUnalignedHighQualitySegmentsShorterThanThis: 20 int ! (NO) consed.primersLookThisFarForForwardVectorInsertJunction: 125 int ! don't change this--if no X's this far from beginning of read, then ! assume that you are in insert ! (NO) consed.primersDNAConcentrationNanomolar: 50.0 double ! used for melting temperature--don't change this! ! (NO) consed.primersMaxMatchElsewhereScore: 17 int ! used for testing false-annealing to template and to vector ! (NO) consed.primersMaxMatchElsewhereScoreForPCR: 21 int ! used for testing false-annealing to template and to vector ! when used with PCR ! (NO) consed.primersMaxSelfMatchScore: 6 int ! cutoff for self-annealing of a primer ! (NO) consed.primersMaxPrimerDimerScoreForPCR: 14 int ! careful changing this ! (NO) consed.primersMinQuality: 30 int ! you must be sure of the sequence of a primer or it won't anneal to ! where you want ! (NO) consed.primersPrintInfoOnRejectedTemplates: true bool ! whether to print which templates were rejected and why (this output ! can be large ) ! (NO) consed.primersSaltConcentrationMillimolar: 50.0 double ! used for melting temperature--don't change this! ! (NO) consed.primersScreenForVector: true bool ! whether or not to screen primers for annealing to vector ! (NO) consed.primersToleranceForDifferentBeginningLocationOfUniversalPrimerReads: 100 int ! different forward reads or different reverse reads ! can differ by up to this amount in the starting location ! If they differ by more, then there is something wrong ! with the template (it is mislabeled?) so don't use it again for ! walking ! (NO) consed.primersTooManyVectorBasesInWalkingRead: 10 int ! if there are this many x's, then don't walk again on this template ! (NO) consed.qualityThresholdForLowConsensusQuality: 25 int // Phil had this changed from 20 to 25 on 15 Jul 98 ! highest low quality. A base at this quality is considered low ! quality. A base higher than this is considered high quality. ! (NO) consed.tagColorPerCentOfBase: 50 int ! (NO) consed.uncompressedChromatDirectory: /tmp RWCString ! (NO) consed.454sff2scfDirectory: /tmp FileName ! when a user asks to see a 454 trace, and sff2scf runs, the ! scf file will be put here. This is hard-coded in sff2scf.c ! (NO) consed.whenMakingFakeReadToJoinContigsAddThisManyBasesOnEitherSideOfAlignedRegion: 200 int ! (NO) consed.writeThisAceFormat: 2 int ! (NO) consed.dumpCoreIfBoundsError: false bool ! (NO) consed.autoFinishMinSmithWatermanScoreOfARun: 20 int ! (NO) consed.autoFinishDoNotComparePCRPrimersMoreThanThisManyTimes: 1.0e+9 double ! When autofinish tries to find a compatible set of pcr primers, it ! can take billions of tries. This limits the number of tries so that, ! if autofinish can't find it in this number of tries, it gives up ! rather than running for days, weeks, years! ! (NO) consed.restrictionDigestMaximumBasesToCompareToVector: 200 int ! (NO) consed.restrictionDigestZoomFactor: 2.0 double ! Amount to zoom in or out in the gel window of the restriction digest ! (NO) consed.restrictionDigestZoomFactorForNavigate: 10.0 double ! When looking at restriction gel and navigating to first problem ! location, this is the amount to zoom in. ! (NO) consed.restrictionDigestToleranceInPositionUnits: 20 int ! (NO) consed.autoPCRAmplifyTooManySeriousFalseMatches: 100 int ! If a pcr primer pair has a significant false match to this many ! other places in the assembly, do not consider for possible pcr ! primer pairs. This is just for the purpose of speeding up picking ! of primer pairs--the higher the number, the faster the searching, ! but the more likely a primer pair will be selected that will ! create multiple products. ! (NO) consed.assemblyViewZoomFactor: 1.5 double ! amount to zoom in or out ! (NO) consed.assemblyViewFilterInconsistentFwdRevPairsIfThisClose: 2000 int ! If forward/reverse pairs start this close together and end this ! close together, they confirm each other. ! (NO) consed.assemblyViewGridCellWidthInPixels: 4.0 double ! for keeping track where objects are on screen. If you make it ! larger, you get better drawing performance, but lower resolution ! of which objects the cursor is pointing at ! (NO) consed.assemblyViewCursorSensitivityInPixels: 4 int ! square about cursor that will detect objects ! (NO) consed.assemblyViewReadDepthQuality: 20 int ! (NO) consed.showAllTracesMaxNumberOfTracesToShowAtOnce: 100 int ! (NO) consed.allowFwdRevPairScaffoldsToBeMergedIfThisManyBasesIntersectionOrLess: 1000 int ! (NO) consed.justForPrimateProject: false bool ! (NO) consed.solexaFilesAreAssumedToBeHere: ../solexa_dir FileName ! any solexa files (or links) are assumed to be in this directory. ! If you change this, it can have effects in 3 places: 1) add new ! reads list of solexa files 2) add new reads where it looks for these ! files and 3) subsequent runs of consed it will prepend this to the ! path it finds in the ace file under PHD_DIR: on the DS line. There ! may be other implications as well. ! (NO) consed.solexaAlignmentFilesPerInsertingPadsCycle: 50 int ! (NO) consed.solexaAlignmentsPerAlignmentFile: 10000 int ! (NO) consed.solexaFastqFilesArePhredQualityNotSolexaQuality: true bool ! (NO) consed.solexa64FastqOrSanger33Fastq: auto RWCString ! valid values are: auto (it figures it out itself), ! solexa64 (+64), and sanger33 (+33) ! If consed is being fooled, you can set these to force ! consed to override what the file appears to be. ! (NO) consed.maximumReadsInReadList: 200000 int ! even if there are millions of reads, don't display them all or ! it will eat up memory and time ! (NO) consed.maxLengthOfReadsInapLocatedFragment2: 10000 int ! (NO) consed.maximumStartupErrorsToReport: 50 int ! (NO) consed.454LinkerAlignmentMatchScore: 1 int ! (NO) consed.454LinkerAlignmentMismatchScore: 3 int ! (NO) consed.454LinkerAlignmentIndelScore: 2 int ! (NO) consed.filter454ReadsDeleteCrossMatchOutput: true bool ! This should be changed to false only for troubleshooting. ! Otherwise unused files will accumulate on your disk. ! (NO) // removed Oct 11, 2010 when removed old method of extending contig ends // when adding new reads //consed.addNewReadsAdditionalConsensusBasesBeyondReads: 500 //int ! These additional consensus bases are added for the miniassembly ! of the reads on the end of the contig. ! (NO) ! Resources here are just those for Green Lab research and have ! no effect on any Consed/Autofinish/AutoReport functions consed.autoReportAllNeededSpeciesCode: 1 int ! if 1, then require PPan|PTro, GGor, PPyg|MMul ! if 2, then require PTro, GGor, PPyg, MMul ! if 3, then require PTro, GGor, PPyg|MMul ! (GREEN LAB) consed.autoReportUseCommasInBigNumbers: true bool ! (GREEN LAB) consed.autoReportPrintToCompareToReich: false bool ! (GREEN LAB) consed.autoReportOnlyAllowSitesThatAreBetweenAcceptableSites: false bool ! in applyFilters. This will guarantee that we can find ! deamination mutations. ! (GREEN LAB) consed.autoReportDeaminationMutationsDeterminedByMoreAccurateMethod: true bool ! in checkTreesAndRecordDeaminationMutations ! whether it uses PPan, GGor, and PPyg as well, or just human, PTro, and MMul ! This helps for comparison with the whole genome analysis which just ! had PTro, HSap, and MMul ! (GREEN LAB) consed.autoReportChooseTreesUsingBadData: true bool ! in applyFilters ! (GREEN LAB) consed.autoReportChooseTreesByCountingDeaminationMutations: true bool ! in applyFilters ! (GREEN LAB) consed.autoReportChooseTreesUsingKimura: true bool ! in applyFilters ! (GREEN LAB) consed.autoReportPrintCrudeChimpHumanMutations: false bool ! (GREEN LAB) consed.autoReportPrintPositionsForGraham: false bool ! used with printFlankedColumns4 ! (GREEN LAB) consed.autoReportPrintAncestralCpGs: false bool ! used with printFlankedColumns4 ! (GREEN LAB) consed.autoReportPrintCpGMutations: false bool ! used with printFlankedColumns4 ! (GREEN LAB) consed.autoReportPrintMutationsWithContext: false bool ! print columns that have mutations with flanking ! columns that are conserved !(GREEN LAB) consed.autoReportCountAllMutationsML: false bool ! counts all types of mutations and uses trees ! based on the probability of each tree !(GREEN LAB) consed.autoReportCountAllMutations: false bool ! counts deamination mutations in pairs of columns that ! both pass filters. !(GREEN LAB) consed.autoReportIgnoreMultipleTrees: false bool ! used with ! consed.autoReportCountAllMutations: false ! (GREEN LAB) consed.autoReportCountAcceptableColumnsWithNoneOnLeft: false bool ! count columns that pass all filters, but column to left of it ! doesn't pass all filters ! (GREEN LAB) consed.autoReportPrintFlankedColumns4: false bool ! This differs from that below primarily in that it ! identifies deamination mutationsx ! (GREEN LAB) consed.autoReportUseAnnotationFormat: false bool ! Used with consed.autoReportPrintFlankedColumns4: ! to print things out in a format that can be used for distinguishing ! the clades ! (GREEN LAB) consed.autoReportPrintFlankedColumns3: false bool ! This differs from that below primarily in that it ! uses n instead of ? and prints trees ! (GREEN LAB) consed.autoReportPrintFlankedColumns2: false bool ! This differs from that below primarily in that it ! doesn't require all species, but rather ! PPan | PTro && GGor && MMul | PPyg ! (GREEN LAB) consed.autoReportPrintFlankedColumns: false bool ! (GREEN LAB) consed.autoReportHighQualitySegmentData: false bool ! (GREEN LAB) consed.autoReportGoodReadsBug: false bool ! (GREEN LAB) consed.autoReportDiscrepancyRateInFlankedRegions: false bool ! (GREEN LAB) consed.autoReportDiscrepancyRateInFlankedRegions2: false bool ! (GREEN LAB) consed.autoReportDiscrepancyRateInFlankedRegions4: false bool ! (GREEN LAB) consed.autoReportDiscrepancyRateInFlankedRegions5: false bool ! (GREEN LAB) consed.autoReportSingleSignalOrQuality: false bool ! (GREEN LAB) consed.autoReportLowQualityBasesInHQS: false bool ! (GREEN LAB) consed.autoReportCompareHQSWithLQS: false bool ! (GREEN LAB) consed.autoReportCountColumnsForGroupsOfSpecies: false bool ! (GREEN LAB) consed.autoReportSingleSignalInfo: false bool ! (GREEN LAB) consed.autoReportSingleSignalInfo2: false bool ! Just used to print out the # of bases at each quality that are ! single signal and the # that are multiple signal. For comparing ! 2004 reads with 2005 reads ! (GREEN LAB) consed.autoReportCompareTopAndBottomStrands: false bool ! (GREEN LAB) consed.autoReportCompareTopAndBottomStrandsNoHuman: false bool ! (GREEN LAB) consed.autoReportCompareTopAndBottomStrands2: false bool ! (GREEN LAB) consed.autoReportCompareTopAndBottomStrands3: false bool ! (GREEN LAB) consed.autoReportCompareTopAndBottomStrands4: false bool ! (GREEN LAB) consed.autoReportTopStrandPinnedPosition: 0 int ! for use with consed.autoReportCompareTopAndBottomStrands ! given in unpadded read pos in direction of sequencing ! (GREEN LAB) consed.autoReportBottomStrandPinnedPosition: 0 int ! for use with consed.autoReportCompareTopAndBottomStrands ! given in unpadded read pos in direction of sequencing ! (GREEN LAB) consed.autoReportCompareTopAndBottomStrandsWithHuman: false bool ! (GREEN LAB) consed.autoReportPrintLengthsOfAlignedSegmentsOfReads: false bool ! (GREEN LAB) consed.autoReportPrintLengthsOfUnalignedHighQualitySegmentsOfReads: false bool ! (GREEN LAB) consed.autoReportPrintIfReadsAreCorrectlyAligned: false bool ! make sure that .f reads are top strand and .r reads are bottom ! strand (Note: this only is true in some projects.) ! (GREEN LAB) consed.autoReportCalculateErrorProbabilitiesByComparingPTroPPan: false bool ! (GREEN LAB) consed.autoReportPrintAgreeDisagreeBetweenPairsOfSpecies: false bool ! (GREEN LAB) consed.autoReportPrintAgreeDisagreeBetweenPairsOfSpecies2: false bool ! differs from above in that one or the other of the species bases ! must be at least quality 45 ! (GREEN LAB) consed.autoReportFilterSingleSignal: true bool ! Green 2004 data should not be filtered for single signal ! Green 2005 data should be ! (GREEN LAB) consed.autoReportGoodHitReads: /me2/gordon/primates/checkHumanGenomeBothYears/goodReadsBothYears.txt FileName ! (GREEN LAB) consed.autoReportQualityWindowLow: 10 int ! (GREEN LAB) consed.autoReportQualityWindowHigh: 15 int ! (GREEN LAB) consed.autoReportPrintNumberOfIsolatedPadsForEachSpecies: false bool ! (GREEN LAB) consed.autoReportPrintNumberOfIsolatedPads: false bool ! (GREEN LAB) consed.autoReportIsolatedPadsOfReadsWithThisPattern: PTro RWCString ! (GREEN LAB) consed.autoReportMinNumberOfPerfectlyAlignedBasesBeforeDiscrepancy: 5 int ! (GREEN LAB) consed.autoReportMaxSizeOfDiscrepantRegion: 3 int ! used for printing bases of a discrepant region ! (GREEN LAB) consed.autoReportSizeOfDiscrepantRegion: 1 int ! size of region between the flanking agreeing region ! duplicates parameter above ! (GREEN LAB) consed.autoReportPrintMinimumQualityHistogram: false bool ! (GREEN LAB) consed.autoReportPrintDiscrepantRegions: false bool ! (GREEN LAB) consed.autoReportPrintBasesInDiscrepantRegions: false bool ! (GREEN LAB) consed.autoReportPrintDiscrepantRegionsButIgnoreReadsContainingThis: RWCString ! (GREEN LAB) consed.autoReportBackboneReadHasThisStringInIt: HSap RWCString ! (GREEN LAB) consed.autoReportPrintDiscrepantRegionsButOnlyIfAboveQualityThreshold: false bool ! if true, ! uses consed.qualityThresholdForFindingHighQualityDiscrepancies ! (GREEN LAB) consed.autoReportPrintSpeciesAlignment: false bool ! (GREEN LAB) consed.autoReportPrintReadAlignment: false bool ! This differs from consed.autoReportPrintSpeciesAlignment in that ! reads that are for the same species are not combined. (This may be ! useful for labs other than the Green Lab.) ! (GREEN LAB) consed.autoReportPrintTheseReads: readsToPrint.txt FileName ! for consed.autoReportPrintReadAlignment ! (GREEN LAB) consed.autoReportPrintReadPositions: false bool ! use with consed.autoReportPrintSpeciesAlignment: ! (GREEN LAB) consed.autoReportPrintChosenReadName: false bool ! use with consed.autoReportPrintSpeciesAlignment: ! (GREEN LAB) consed.autoReportNumbersOfCharactersOfChosenReadNameToBePrinted: 1 int ! if the read name is larger than this, will print this number ! of characters at the end of the name. If the read name is shorter, ! will just print the read name. ! (GREEN LAB) consed.autoReportPrefix: 1 RWCString ! normally this will be the chromosome # ! (GREEN LAB) consed.autoReportUseOldCriteriaForDeletingColumnsOfPads: false bool ! I think: ! old: delete column of pads unless there is a certain non-pad (single ! signal, high quality, hqs, good hit read), aggressive method ! new: delete column of pads only if all combined reads are certain ! pads (high quality, high quality segment, single signal, good hit) ! conservative method ! (GREEN LAB) consed.autoReportDeleteColumnsOfPadsBeforeAdjustingReadQualityValues: true bool ! (GREEN LAB) consed.autoReportFlankingBasesMustBeSingleSignal: false bool ! for use with consed.autoReportPrintMutationsWithContext: ! and others ! (GREEN LAB) consed.autoReportMinimumQualityOfFlankingBases: 0 int ! for use with consed.autoReportPrintMutationsWithContext: ! and others ! (GREEN LAB) consed.autoReportFlankingBasesMustBeInHighQualitySegment: false bool ! (GREEN LAB) consed.autoReportSpecies: PPan PTro GGor PPyg MMul RWCString ! These must match primateSpecies.h constants ! nPPan, nPTro, nGGor, nPPyg, and nMMul ! (GREEN LAB) END_MISC_RESOURCES