/***************************************************************************** # Copyright (C) 1994-2008 by David Gordon. # All rights reserved. # # This software is part of a beta-test version of the Consed/Autofinish # package. It should not be redistributed or # used for any commercial purpose, including commercially funded # sequencing, without written permission from the author and the # University of Washington. # # This software is provided ``AS IS'' and any express or implied # warranties, including, but not limited to, the implied warranties of # merchantability and fitness for a particular purpose, are disclaimed. # In no event shall the authors or the University of Washington be # liable for any direct, indirect, incidental, special, exemplary, or # consequential damages (including, but not limited to, procurement of # substitute goods or services; loss of use, data, or profits; or # business interruption) however caused and on any theory of liability, # whether in contract, strict liability, or tort (including negligence # or otherwise) arising in any way out of the use of this software, even # if advised of the possibility of such damage. # # Building Consed from source is error prone and not simple which is # why I provide executables. Due to time limitations I cannot # provide any assistance in building Consed. Even if you do not # modify the source, you may introduce errors due to using a # different version of the compiler, a different version of motif, # different versions of other libraries than I used, etc. For this # reason, if you discover Consed bugs, I can only offer help with # those bugs if you first reproduce those bugs with an executable # provided by me--not an executable you have built. # # Modifying Consed is also difficult. Although Consed is modular, # some modules are used by many other modules. Thus making a change # in one place can have unforeseen effects on many other features. # It may takes months for you to notice these other side-effects # which may not seen connected at all. It is not feasable for me to # provide help with modifying Consed sources because of the # potentially huge amount of time involved. # #*****************************************************************************/ #ifndef fallbackConsedResources_included #define fallbackConsedResources_included static char* aszFallbackConsedResources[] = { "consed.showProteinTranslation: false", "consed.colorHighlightBackground: Yellow", "consed.colorHighlightForegroundX: Black", "consed.colorMeansMatch_same: CadetBlue1", "consed.colorMeansMatch_different: Orange", "consed.colorMeansMatch_clippedEnds: Grey50", "consed.colorMeansMatch_consensus: Yellow", "consed.colorMeansMatch_lowQualConsensus: Gold3", "consed.colorConsensusLabel: Yellow", "consed.colorConsensusLabelBackground: Black", "consed.colorMeansQualityAgree: Black", "consed.colorMeansQualityDisagree: red2", "consed.colorMeansQualityConsensusForeground: Purple4", "consed.colorMeansQuality0_4: grey39", "consed.colorMeansQuality5_9: grey47", "consed.colorMeansQuality10_14: grey54", "consed.colorMeansQuality15_19: grey60", "consed.colorMeansQuality20_24: grey66", "consed.colorMeansQuality25_29: grey77", "consed.colorMeansQuality30_34: grey86", "consed.colorMeansQuality35_39: grey91", "consed.colorMeansQuality40_97: white", "consed.colorMeansQuality98: grey39", "consed.colorMeansQuality99: white", "consed.colorMeansEditedAgree: Dark Goldenrod", "consed.colorMeansEditedDisagree: red2", "consed.colorMeansEditedUnedited: Black", "consed.colorMeansEdited98: grey66", "consed.colorMeansEdited99: white", "consed.colorVerticalScrollbarScrolledDown: green", "consed.colorMode_editCursorForeground: White", "consed.colorMode_editCursorBackground: Red", "consed.colorTracesA: chartreuse3", "consed.colorTracesC: CadetBlue1", "consed.colorTracesG: Orange", "consed.colorTracesT: Red", "consed.colorTracesN: Purple", "consed.colorTracesPad: Magenta", "consed.colorScale: Yellow", "consed.colorScaleBackground: Black", "consed.colorHighlightedReadNames: Magenta", "consed.colorSequencingDirectionArrow: Yellow", "consed.colorSequencingDirectionArrowTracesUp: Magenta", "consed.colorVerticalLineAtCursor: Green", "consed.colorHorizontalLineAtCursor: Green", "consed.colorProteinTranslation: Yellow", "consed.colorProteinTranslationLabels: Yellow", "consed.colorProteinStartCodon: deep pink", "consed.colorProteinStopCodon: deep pink", "consed.colorUnmatchedRestrictionFragment: Red", "consed.colorRestrictionFragmentPairTooFarApart: Red", "consed.colorRestrictionFragmentInContig: black", "consed.colorRestrictionFragmentPartlyOffContig: yellow", "consed.colorRestrictionFragmentEntirelyOffContig: blue", "consed.colorActualGelRestrictionFragment: black", "consed.colorRestrictionDigestScale: black", "consed.colorRestrictionDigestCursorIndicator: black ", "consed.colorRestrictionFragmentsOnTopOfEachOther: purple", "consed.colorAssemblyViewScale: black", "consed.colorAssemblyViewScaleNumbers: black", "consed.colorAssemblyViewContigs: grey45", "consed.colorAssemblyViewContigNamesForeground: floral white", "consed.colorAssemblyViewContigNamesBackground: Deep Pink", "consed.colorAssemblyViewConsistentFwdRevPairs: blue1", "consed.colorAssemblyViewConsistentFwdRevPairDepth: green", "consed.colorAssemblyViewReadDepth: medium sea green", "consed.colorAssemblyViewDiscrepanciesNotIndels: Yellow", "consed.colorAssemblyViewDiscrepanciesIndels: Magenta", "consed.colorAssemblyViewTooFewConsistentFwdRevPairs: red2", "consed.colorAssemblyViewInconsistentFwdRevPair: red2", "consed.colorAssemblyViewConsistentGapSpanningFwdRevPair: cyan4", "consed.colorAssemblyViewHighlight: yellow", "consed.colorAssemblyViewMultipleItemsOnTopOfEachOther: purple", "consed.colorAssemblyViewDirectSequenceMatches: darkorange", "consed.colorAssemblyViewInvertedSequenceMatches: black", "consed.colorAssemblyViewConsistentRestrictionDigestFragment1: cyan1", "consed.colorAssemblyViewConsistentRestrictionDigestFragment2: forest green", "consed.colorAssemblyViewConsistentRestrictionDigestFragment3: pale green", "consed.colorAssemblyViewConsistentRestrictionDigestFragment4: plum", "consed.colorAssemblyViewConsistentRestrictionDigestFragment5: burlywood", "consed.colorAssemblyViewConsistentRestrictionDigestFragment6: medium sea green", "consed.colorAssemblyViewConsistentRestrictionDigestFragment7: peachpuff3", "consed.colorAssemblyViewConsistentRestrictionDigestFragment8: plum", "consed.colorAssemblyViewConsistentRestrictionDigestFragment9: khaki", "consed.colorAssemblyViewConsistentRestrictionDigestFragment10: tan", "consed.colorAssemblyViewInconsistentRestrictionDigestFragment: red", "consed.colorAssemblyViewCloneEnd: light coral", "consed.colorReadPrefixDefault: blue", // tag name // whether tag is read tag, consensus tag, or both // true or false (whether user can create tag by swiping "consed.tagColorEdit: DarkOliveGreen1", "consed.tagColorBecomeConsensus: NavajoWhite3", "consed.tagColorIgnoreMismatches: SeaGreen1", "consed.tagColorIgnoreMatches: orange", "consed.tagColorSignificantDiscrepancy: Plum1", "consed.tagColorCompression: brown3", "consed.tagColorDataNeeded: gold", "consed.tagColorComment: SkyBlue1", "consed.tagColorTagsOverlap: magenta4", "consed.tagColorSequencingVector: LightPink1", "consed.tagColorCloningVector: Cyan", "consed.tagColorVector: LightSalmon", "consed.tagColorOligo: Yellow", "consed.tagColorOligo3PrimeEnd: Red", "consed.tagColorChimera: DarkSeaGreen3", "consed.tagColorContigName: Aquamarine", "consed.tagColorPolymorphism: SlateBlue2", "consed.tagColorHomozygoteAA: SlateBlue2", "consed.tagColorHomozygoteCC: SlateBlue2", "consed.tagColorHomozygoteGG: SlateBlue2", "consed.tagColorHomozygoteTT: SlateBlue2", "consed.tagColorHeterozygoteAC: Pink", "consed.tagColorHeterozygoteAG: Pink", "consed.tagColorHeterozygoteAT: Pink", "consed.tagColorHeterozygoteCG: Pink", "consed.tagColorHeterozygoteCT: Pink", "consed.tagColorHeterozygoteGT: Pink", "consed.tagColorRepeat: DodgerBlue", "consed.tagColorPolyPhredRank1: Red", "consed.tagColorPolyPhredRank2: Orange", "consed.tagColorPolyPhredRank3: MediumSeaGreen", "consed.tagColorPolyPhredRank4: Blue", "consed.tagColorPolyPhredRank5: orchid1", "consed.tagColorPolyPhredRank6: purple", // Jim Sloan said not using polyphredrank tags greater than 6. // October 2002 // following added by Jim Sloan, Oct 2002: "consed.tagColorIndelSite: DarkCyan", "consed.tagColorHeterozygoteIndel: DarkOrange", "consed.tagColorHomozygoteIndel: SlateBlue2", "consed.tagColorPolymorphismConfirmed: orange", // phil said (980708) that users cannot create matchElsewhere tags, // but can create G_dropout and compression tags // The last 2 only apply to reads, but matchElsewhere can be either "consed.tagColorMatchElsewhereHighQual: green", "consed.tagColorMatchElsewhereLowQual: aquamarine", "consed.tagColorG_dropout: Plum1", "consed.tagColorMarkedHighQuality: orange", "consed.tagColorMarkedLowQuality: NavajoWhite3", "consed.tagColorAutoFinishExp: turquoise4", "consed.tagColorDoNotFinish: saddle brown", "consed.tagColorDoNotDoPCR: yellow green", "consed.tagColorConsedFixedGoldenPath: tomato4", "consed.tagColorCloneEnd: aquamarine", "consed.tagColorEditable: aquamarine", "consed.tagColorContigEndPair: RosyBrown1", // requested by Jim Sloan, Jan 2004 "consed.tagColorChangedGenotype: cyan3", "consed.tagColorStartNumberingConsensus: DarkSeaGreen3", // works with consed.numberUnpaddedConsensusAtUserDefined: true "consed.tagColorReferenceSequence: yellow", // designates this sequence the reference sequence for the purpose of // various navigation/polymorphism functions "consed.tagColorJoin: chartreuse", // tear tag is hard-coded in addTearTagType.cpp "consed.customTag1:", "consed.tagColorCustomTag1:", "consed.customTag2:", "consed.tagColorCustomTag2:", "consed.customTag3:", "consed.tagColorCustomTag3:", "consed.customTag4:", "consed.tagColorCustomTag4:", "consed.customTag5:", "consed.tagColorCustomTag5:", "consed.customTag6:", "consed.tagColorCustomTag6:", "consed.customTag7:", "consed.tagColorCustomTag7:", "consed.customTag8:", "consed.tagColorCustomTag8:", "consed.customTag9:", "consed.tagColorCustomTag9:", "consed.customTag10:", "consed.tagColorCustomTag10:", "consed.customTag11:", "consed.tagColorCustomTag11:", "consed.customTag12:", "consed.tagColorCustomTag12:", "consed.customTag13:", "consed.tagColorCustomTag13:", "consed.customTag14:", "consed.tagColorCustomTag14:", "consed.customTag15:", "consed.tagColorCustomTag15:", "consed.customConsensusTag1:", "consed.tagColorCustomConsensusTag1:", "consed.customConsensusTag2:", "consed.tagColorCustomConsensusTag2:", "consed.customConsensusTag3:", "consed.tagColorCustomConsensusTag3:", "consed.customConsensusTag4:", "consed.tagColorCustomConsensusTag4:", "consed.customConsensusTag5:", "consed.tagColorCustomConsensusTag5:", "consed.customConsensusTag6:", "consed.tagColorCustomConsensusTag6:", "consed.customConsensusTag7:", "consed.tagColorCustomConsensusTag7:", "consed.customConsensusTag8:", "consed.tagColorCustomConsensusTag8:", "consed.customConsensusTag9:", "consed.tagColorCustomConsensusTag9:", "consed.customConsensusTag10:", "consed.tagColorCustomConsensusTag10:", "consed.customConsensusTag11:", "consed.tagColorCustomConsensusTag11:", "consed.customConsensusTag12:", "consed.tagColorCustomConsensusTag12:", "consed.customConsensusTag13:", "consed.tagColorCustomConsensusTag13:", "consed.customConsensusTag14:", "consed.tagColorCustomConsensusTag14:", "consed.customConsensusTag15:", "consed.tagColorCustomConsensusTag15:", // In the following, I have annotated the parameters with the following // symbols: // // (YES) freely customize to your own site // (OK) don't change unless you have a specific need and know what you // are doing // (NO) don't change this! // (GREEN LAB) Resources here are just those for Green Lab research and have // no effect on any Consed/Autofinish/AutoReport functions // // // parameters in the (YES) category: // "consed.printPS: true", // print memory // (YES) "consed.defaultTagType: polymorphism", // when swiping the consensus in the Aligned Reads Window to create a // tag, what is the default tag type to be added? // (YES) "consed.defaultTagOnConsensusNotReads: true", // when swiping the consensus in the Aligned Reads Window to create a // tag, by default will the consensus be tagged or the reads be tagged? // (YES) "consed.autoFinishMinNumberOfErrorsFixedByAnExp: 0.02", // if an experiment solves fewer errors than this, it isn't worth doing // so won't be chosen. This parameter controls when Autofinish stops // choosing experiments. // (YES) "consed.autoFinishRedundancy: 2.0", // This number should be between 1.0 and 2.0 If you want more reads // for each area, increase the number towards 2.0 If you want fewer // reads per area, decrease it towards 1.0. This only affects // universal primer reads--not custom primer reads. // // (YES) "consed.autoFinishAverageInsertSize: 1500", // If a template has a forward but no reverse, when deciding whether to // allow this template for a particular primer or reverse, we need to // make an assumption of where is the end of the template. If we have // do not have enough forward/reverse pairs to determine the mean, then // this parameter is used. // (YES) "consed.primersMaxInsertSizeOfASubclone: 3000", // for checking for false-annealing // check +/- this distance from the primer for false-annealing // and check at most this distance for templates for a primer. // Thus if you have more than one library, make this the max of // all libraries. // (YES) "consed.primersMaxMeltingTemp: 60", // (YES) "consed.primersMaxMeltingTempForPCR: 58", // Note: the difference between consed.primersMaxMeltingTempForPCR and // consed.primersMinMeltingTempForPCR must be less than or equal to // consed.primersMaxMeltingTempDifferenceForPCR // Otherwise, autofinish may take forever to pick pcr primers. // (YES) "consed.primersPickTemplatesForPrimers: true", // when picking primers for subclone templates, pick templates also. // If there is no suitable template for a primer, do not pick the // primer. If you like to pick your own templates, you might want to // turn this off for a little improvement in speed. // This has no effect on Autofinish--just on interactive primer picking // in Consed. // (YES) "consed.primersSubcloneFullPathnameOfFileOfSequencesForScreening: $CONSED_HOME/lib/screenLibs/primerSubcloneScreen.seq", // vector sequence file if choosing subclone (e.g., M13, plasmid) // templates // (YES) "consed.primersCloneFullPathnameOfFileOfSequencesForScreening: $CONSED_HOME/lib/screenLibs/primerCloneScreen.seq", // vector sequence file if choosing clone (e.g., cosmid, BAC) template // (YES) "consed.primersMinMeltingTemp: 55", // (YES) "consed.primersMinMeltingTempForPCR: 55", // (YES) "consed.searchFunctionsUseUnalignedEndsOfReads: false", // when navigating by // searchForSingleSubcloneRegions and searchForSingleStrandedRegions, // and the read below has both aligned and unaligned portions, which // bases of the read are considered to cover the region: // uuuuuuuAAAAAAAAAAAAAAAAAAAAAAAAAuuuuuuuu // <--------- if "true" ------------------> // <-----if "false"--------> // where u means an unaligned base and A means an aligned base // (YES) "consed.searchFunctionsUseLowQualityEndsOfReads: true", // when navigating by // searchForSingleSubcloneRegions and searchForSingleStrandedRegions, // and the read below has both low quality and high quality portions, // which portions of the read are considered to cover the region: // lllllllAAAAAAAAAAAAAAAAAAAAAAAAAllllllll // <--------- if "true" ------------------> // <-----if "false"--------> // where l means a low quality base and A means a high quality base // (YES) "consed.inexactSearchForStringMaxPerCentMismatch: 5", // when using the inexact search for string, allow up to this // % mismatch: the sum of the insertion, deletion, and substitution // differences divided by the length of the query string // (YES) "consed.onlyAllowOneReadWriteConsedAtATime: false", // if there is another read-write consed (or Autofinish) process running in the // same directory, and this consed (or Autofinish) is not read-only, // then terminate with an error message // (YES) "consed.autoFinishAllowHighQualityDiscrepanciesInTemplateIfConsistentForwardReversePair: true", // otherwise, a single serious hqd will cause the template to be rejected. // (YES) "consed.printWindowCommand: /usr/bin/X11/xwd | /usr/bin/X11/xpr | /bin/lp -dlevulose", // system command to print out a Consed Window // (YES) "consed.fileOfTagTypes:", // pathname of a file with the following format: // (tag name) (color for displaying) (consensus or read or both) (yes/no) // where "consensus" or "read" or "both" indicates whether the tag // is available for the user to add to the consensus, to reads, or to // both, and "yes" or "no" indicates whether the tag can be created // in Consed by swiping, or whether it only can be created by an // external program and displayed by Consed. // (YES) "consed.assemblyViewShowConsistentFwdRevPairs: false", // too many squares! See assemblyViewShowConsistentFwdRevPairDepth // (YES) "consed.assemblyViewShowConsistentFwdRevPairDepth: false", // This actually shows more information than // assemblyViewShowConsistentFwdRevPairs and is much easier to read // (YES) "consed.assemblyViewShowConsistentFwdRevPairsBetweenDifferentScaffolds: true", // Lone links from the end of one contig to the end of another, but not // confirmed by another in order to make the contigs joined into a scaffold. // (YES) "consed.assemblyViewShowLegsOnSquaresForConsistentFwdRevPairs: false", // This is even more cluttered than assemblyViewShowConsistentFwdRevPairs // (YES) "consed.assemblyViewShowGapSpanningFwdRevPairs: true", // This shows gap-spanning fwd/rev pairs that caused the contigs to // be joined into a scaffold. // (YES) "consed.assemblyViewShowWhichInconsistentFwdRevPairs: filtered", // choices are: filtered, none, all // "filtered" means that an inconsistent fwd/rev pair is only shown // if it is confirmed by another inconsistent fwd/rev pair // If all, full of red lines. If filtered, then only red lines that are // confirmed by other red lines are shown. // (YES) "consed.assemblyViewShowReadDepth: true", // If true, read depth is shown in assemblyView // (YES) "consed.assemblyViewShowMultipleHighQualityDiscrepancies: false", // If true, multiple high quality discrepancies (both indel and // non-indel type) are shown in assemblyView // (YES) "consed.assemblyViewShowRestrictionDigestCutSites: true", // If true, and you open a Digest Window in Consed and you open // the Assembly View window in Consed, the restriction digest cut // sites will be shown in Assembly View (in addition to showing them in // the Digest Window) // (YES) "consed.assemblyViewFilterSequenceMatchesBySize: false", // only show sequence matches if they fall between // consed.assemblyViewSequenceMatchesMinSize and // consed.assemblyViewSequenceMatchesMaxSize // (YES) "consed.assemblyViewSequenceMatchesMinSize: 100", // if consed.assemblyViewFilterSequenceMatchesBySize is true, // then only show sequence matches that are larger than this // (YES) "consed.assemblyViewSequenceMatchesMaxSize: 10000", // if consed.assemblyViewFilterSequenceMatchesBySize is true, // then only show sequence matches that are smaller than this // (YES) "consed.assemblyViewAutomaticallyStartWithConsed: false", // when consed starts, start assembly view. This only works if you // specify the ace file on the command line. // (YES) "consed.assemblyViewDisplayTheseTagTypesOnTheseLines: edit 0 matchElsewhereHighQual 1 matchElsewhereLowQual 2", // space-separated list of form: // (tagtype) (line number) (tagtype) (line number) // where line number is where in Assembly View the tag will be displayed // (YES) "consed.assemblyViewShowTags: true", // If true, and some tag types are selected, these tags // will be shown in assemblyView. If false, no tags // will be shown in assemblyView. // (YES) "consed.autoEditRecalculateHighQualitySegmentsOfReads: false", // If true, will recalculate the high quality segments of the reads // (YES) "consed.autoEditConvertCloneEndBasesToXs: true", // If true, will convert to X's bases of all reads that protrude beyond a // cloneEnd tag. // (YES) "consed.autoEditTellPhrapNotToOverlapMultiplyDiscrepantReads: true", // This will find all locations where there are multiple identical // discrepancies with the consensus (and some other conditions) and try // to make most of the reads quality 99 at that location so that phrap, // next time it is run, will not overlap those reads. This will fix // many misassemblies. // (YES) "consed.autoEditTagEditableLowConsensusQualityRegions: true", // This will find regions that are low quality, but that a human // finisher could easily determine the correct base and thus // money could be saved by not having Autofinish suggest additional // reads overlapping the region // (YES) "consed.autoEditMakeFakeRead: false", // takes a list of reads and makes a false read that consists of the // combination of those reads (using the consensus to fill in between // them) // (YES) "consed.autoEditMakeFakeReadFromRead1: read1", // read 1 from which to make the fake read "consed.autoEditMakeFakeReadFromRead2: read2", // read 2 from which to make the fake read "consed.autoEditMakeFakeReadName: mama", // name of fake read "consed.autoEditMakeFakeReadFastaFilename: mama.fa", // name of fasta file to put the read into "consed.autoEditMergeAssembly: false", // This is used to take 2 assemblies (each with a single contig) that // have a read in common and merge them into a single assembly with a // single contig as follows: It reads consed.autoEditSecondaryAceFile // into a secondary assembly and finds read // consed.autoEditMakeFakeReadName within that secondary assembly as well // as within the primary assembly. It assumes that these reads have the // same unpadded bases (although they may have different pads). It // equalizes the pads, and then moves the other reads (which are // typically the fwd/rev pair of reads) from the secondary assembly into // the primary assembly. It then deletes the secondary assembly and // deletes consed.autoEditMakeFakeReadName from the primary assembly. // (YES) "consed.autoEditSecondaryAceFile: mama.ace", // ace file of the fake read and the forward/reverse pair "consed.autoEditFixRunsInConsensus: false", // fixes this: // ccc (cons) // cc* (read1) // *cc (read2) // (YES) "consed.showAllTracesJustShowGoodTraces: true", // Just show traces where there is a base at the cursor and // there is trace signal at the cursor and where // there is no "dataNeeded" tag at the cursor as specified by // consed.showAllTracesDoNotShowTraceIfTheseTagsPresent // (YES) "consed.addAlignedSequenceQualityOfBases: 40", // when running consed -addAlignedSequence, what quality should the // bases be? // (YES) "consed.makeLightBackgroundInAlignedReadsWindowAndTracesWindow: false", // for printing screens, saves toner // (YES) "consed.putVerticalLineAtCursor: true", // for very high depth of coverage regions, a line helps your eye see // follow the column // (YES) "consed.putHorizontalLineAtCursor: true", // for very wide monitors, helps to follow a read with your eye // (YES) "consed.highlightedReadsFile: highlighted_reads.txt", // The user can use the "Misc/save highlighted reads to file" function // to save highlighted read names to this file. // (YES) // // // parameters in the (OK) category: // // // "consed.autoReportPrintReadNamesInRegion: false", //(OK) "consed.autoReportPrintReadNamesInRegionContig: Contig1", //(OK) "consed.autoReportPrintReadNamesInRegionLeftPos: 1", //(OK) "consed.autoReportPrintReadNamesInRegionRightPos: 1000", //(OK) "consed.autoReportPrintHighlyDiscrepantRegions: false", // motivated by solexa reads. Print where many reads disagree with // reference sequence // uses: // consed.qualityThresholdForFindingHighQualityDiscrepancies // ignores bases lower than this // consed.navigateByHighlyDiscrepantPositionsMinDiscrepantReads // consed.navigateByHighlyDiscrepantPositionsMaxDepthOfCoverage // consed.navigateByHighlyDiscrepantPositionsIgnoreBasesBelowThisQuality // consed.navigateByHighlyDiscrepantPositionsJustListIndels // consed.navigateByHighlyDiscrepantPositionsIgnoreIfNOrXInConsensus: false // (OK) "consed.autoReportPrintScaffolds: false", // (OK) "consed.numberUnpaddedConsensusAtUserDefined: true", // allow user to put a tag on the consensus to specify the number to // start numbering the consensus. // Must use tag consed.tagColorStartNumberingConsensus as the // tag with the number in it. // (OK) "consed.autoReportPrintHighQualityDiscrepancies: false", // (OK) "consed.autoReportHighQualityDiscrepanciesExcludeCompressionOrG_dropoutTags: true", // used in connection with consed.autoReportPrintHighQualityDiscrepancies // (OK) "consed.autoReportHighQualityDiscrepanciesExcludeMostPads: true", // used in connection with consed.autoReportPrintHighQualityDiscrepancies // Excludes high quality discrepancy pads except those in cases such as this: // consensus aa // read 1 *a // read 2 *a // read 3 a* // read 4 a* // (OK) "consed.autoReportPrintLowConsensusQualityRegions: false", // (OK) "consed.autoReportPrintSingleSubcloneRegions: false", // (OK) "consed.autoReportPrintSingleStrandedRegions: false", // (OK) "consed.autoReportPrintLinkingForwardReversePairs: false", // (OK) "consed.autoReportPrintFilteredInconsistentForwardReversePairs: false", // (OK) "consed.autoReportPrintAssemblySummary: false", // (OK) "consed.showAllTracesDoNotShowTraceIfTheseTagsPresent: dataNeeded ", // See consed.showAllTracesJustShowGoodTraces // (OK) "consed.nameOfFakeJoiningReadsIncludesAceFileName: false", // This is useful if the user is going to combine the reads // from a number of different ace files together. // (OK) "consed.whenUserScrollsOffWindowMillisecondsBetweenScrolling: 250", // (OK) "consed.whenUserScrollsOffWindowBasesToScrollEachTime: 15", // (OK) "consed.compareContigsUseBandedRatherThanFullSmithWaterman: true", // (OK) "consed.compareContigsBandSize: 50", // band size of banded Smith Waterman // (OK) "consed.assemblyViewShowFwdRevPairDepthsInRedIfOnlyThisMany: 1", // (OK) "consed.assemblyViewShowSequenceMatches: true", // When false, do not show any sequence matches (repeats) // at all in Assembly View. // Some people like to start out this way since displaying sequence // matches slows down scrolling. // (OK) "consed.assemblyViewOKToShowSequenceMatchesBetweenContigs: true", // (OK) "consed.assemblyViewOKToShowSequenceMatchesWithinContigs: true", // (OK) "consed.assemblyViewOKToShowDirectSequenceMatches: true", // This means in which neither copy must be complemented with respect // to the way it is in the scaffold as created by Consed. // (OK) "consed.assemblyViewOKToShowInvertedSequenceMatches: true", // This means that exactly one copy must be complemented with respect // to the way it is in the scaffold as created by Consed. // (OK) "consed.assemblyViewOnlyShowSequenceMatchesToAParticularRegion: false", // You must set consed.assemblyViewOnlyShowSequencematchesToThisContig // consed.assemblyViewOnlyShowSequenceMatchesToThisRegionLeft // consed.assemblyViewOnlyShowSequenceMatchesToThisRegionRight // (OK) "consed.assemblyViewOnlyShowSequenceMatchesToThisContig:", // You must make // consed.assemblyViewOnlyShowSequenceMatchesToAParticularRegion: true // (OK) "consed.assemblyViewOnlyShowSequenceMatchesToThisRegionLeft: 0", // consed.assemblyViewOnlyShowSequenceMatchesToAParticularRegion: true // (OK) "consed.assemblyViewOnlyShowSequenceMatchesToThisRegionRight: 0", // consed.assemblyViewOnlyShowSequenceMatchesToAParticularRegion: true // (OK) "consed.assemblyViewOnlyShowSequenceMatchesToEndsOfContigs: false", // (OK) "consed.assemblyViewOnlyShowSequenceMatchesToEndsOfContigsThisFar: 1000", // This many base pairs from the end of the contig. // (OK) "consed.defaultReadPrefix: *", // This is used as the character to prefix reads with when the // read is in consed.readPrefixesFile and the prefix is not specified. // (OK) "consed.readPrefixesFile: readPrefixes.txt", // This file should contain a list of reads that you would want to // have prefixes in the Aligned Reads Window. Each line should // have the following format: // (read name) (prefix) (color) // The prefix and color are optional. You can have a line like this: // (read name) (prefix) // or this: // (read name) // but not this: // (read name) (color) // If the color is not specified, the color will default to // consed.colorReadPrefixes: blue // If the prefix is not specified, it will default to // (OK) "consed.maxCharsDisplayedForReadPrefix: 1", // It is still ok to have long read prefixes in the file // consed.readPrefixesFile but only this many characters // will be displayed in the Aligned Reads window // (OK) "consed.autoFinishDoNotDoPCRIfThisManyAvailableGapSpanningTemplates: 2", // (OK) "consed.autoFinishDoNotDoUnorientedPCRIfThisManyOrMoreUnorientedPCRReactions: 6", // \"unoriented\" pcr reactions means cases in which autofinish is suggesting // a pcr reaction to span a gap, but it doesn't know whether the 2 contig ends // really go together since there are not enough (or no)templates that span // that gap // (OK) "consed.autoFinishDoNotDoOrientedPCRIfGapSizeLargerThanThis: 10000", // Gap size can be specified in user-defined contigEndPair tags in a // gap_size: field // If the gap size is greater than this number, do not do PCR. // (OK) "consed.autoFinishDoNotDoPCRIfEndIsExtendedByReads: false", // If this is true, and autofinish was able to walk off the end of a // contig, do not do PCR with that end of the contig. // // (OK) "consed.autoFinishMaxAcceptableErrorsPerMegabase: 0", // target error rate. This parameter used to be the one that stopped // Autofinish from calling more reads. However, consider a BAC that is // nearly perfect except for one region with 3 quality 10 bases in a // row. In this case the global errors per megabase is very // low--perhaps lower than 1 error per megabase. Despite this, most // labs would like to do one more read to fix this problem. Thus we // set this parameter to zero (to disable it) so Autofinish will use // the parameter consed.autoFinishMinNumberOfErrorsFixedByAnExp to stop // calling more reads--it is a local error rate. // (OK) "consed.autoFinishIfNotEnoughFwdRevPairsUseThisPerCentOfInsertSize: 90", // If a template has a forward but no reverse, when deciding whether to // allow this template for a particular primer, we need to make an assumption // of where is the end of the template. If the template comes from a library // with insert size 1500, it would be reasonable to assume that the end of // template will be 1500 bases from the forward read. But if this template // has an insert that is shorter than average, the walk may walk into vector. // To be conservative, we may want to assume that the insert is somewhat // shorter than average. By default, we assume that it is 90% as large as // the average. This parameter gives that percentage. This parameter // is used both by Consed and Autofinish. // (OK) "consed.primersNumberOfBasesToBackUpToStartLooking: 50", // e.g., if this is 50 and you want a read at position 1000, primers // will be searched before base 950 but not in the region 950 to 1000 // This has no effect on Autofinish--just on interactively picking primers. // (OK) "consed.primersMakePCRPrimersThisManyBasesBackFromEndOfHighQualitySegment: 100", // When a PCR product is made, you want it to overlap by this many bases // the high quality part of the existing consensus. Thus choose PCR // primers this many bases back (or more) // (OK) "consed.primersOKToChoosePrimersInSingleSubcloneRegion: true", // (OK) "consed.primersOKToChoosePrimersWhereHighQualityDiscrepancies: false", // (OK) "consed.primersOKToChoosePrimersWhereUnalignedHighQualityRegion: false", // (OK) "consed.autoFinishCallReversesToFlankGaps: true", // if there is a forward-reverse pair flanking a gap, print it out // if there is not, suggest reverses to flank the gap // (OK) "consed.autoFinishAllowWholeCloneReads: false", // ok to call reads whose template for sequencing reaction is the // entire clone (BAC or cosmid) // (OK) "consed.autoFinishAllowCustomPrimerSubcloneReads: true", // ok to call reads with custom primers and subclone template // (OK) "consed.autoFinishAllowResequencingReads: true", // This is just universal primer reads to be resequenced using // dye terminator chemistry or special chemistry. (It does not // mean resequencing a custom primer read.) // (OK) "consed.autoFinishAllowResequencingReadsOnlyForRunsAndStops: false", // This parameter only has any effect when // consed.autoFinishAllowResequencingReads is set to true. In that // case no resequencing reads will be suggested, unless it is to cross // a run or stop and special chemistry is suggested. // (OK) "consed.autoFinishAllowDeNovoUniversalPrimerSubcloneReads: true", // Allows calling reverse when there is just a forward. // Allows calling a forward when there is just a reverse. // (OK) "consed.autoFinishAllowMinilibraries: false", // Allows calling minilibraries (shatter libraries or transposon // libraries) of subclone templates for closing gaps // (OK) "consed.autoFinishAllowPCR: true", // Allows calling PCR for closing gaps, but only as a last resort // (OK) "consed.autoFinishAllowUnorientedPCRReactions: true", // Allows calling PCR amongst contig-ends that have insufficient // fwd/rev pair linkage to any other contig-end. Thus it suggests // pcr amongst all such contig-ends. // To allow this type of pcr, you must also make: // consed.autoFinishAllowPCRForUnorientedContigEnds: true // See also: // consed.autoFinishDoNotDoUnorientedPCRIfThisManyOrMoreUnorientedPCRReactions: // which gives you finer control over unoriented pcr. // (OK) "consed.autoFinishAllowResequencingAUniversalPrimerAutofinishRead: false", // if Autofinish suggests a de novo universal primer read, // do not allow Autofinish to suggest a resequence of this read // (OK) "consed.autoFinishAlwaysCloseGapsUsingMinilibraries: false", // \"Minilibraries\" includes transposing a subclone template or // making a shatter library from a subclone template // (OK) "consed.autoFinishMaximumFinishingReadLength: 2000", // Change this only if your finishing reads are typically shorter // than your shotgun reads. Otherwise, leave it unrealistically long, // and Autofinish will set its model read based on your existing // shotgun reads. // (OK) "consed.autoFinishSuggestMinilibraryIfGapThisManyBasesOrLarger: 800", // (OK) "consed.autoFinishSuggestSpecialChemistryForRunsAndStops: true", // Suggest special chemistry such as dGTP for reads that cross // mononucleotide or dinucleotide repeats that cause reads to fail or // stops (structure) that cause reads to fail and thus dye terminator // reads won't work. // (OK) "consed.autoFinishSuggestThisManyMinilibrariesPerGap: 2", // (OK) "consed.primersWindowSizeInLooking: 450", // e.g., if this is 300, with example above, primers will be searched // from base 650 to 950. This has no effect on Autofinish--it is just // used for interactive primer picking in Consed. // (OK) "consed.primersAssumeTemplatesAreDoubleStrandedUnlessSpecified: false", // you can put the template type in the phd file in a WR template item // consed will have a list of these and know which are single and // double stranded // (OK) "consed.alignedReadsWindowInitialCharsWide: 60", // initial width of the aligned reads window including the read name and // the bases // (OK) "consed.alignedReadsWindowInitialCharsHigh: 20", // initial height of the aligned reads window area where the consensus // and reads are // (OK) "consed.alignedReadsWindowMaxCharsForReadNames: 20", // how many columns are reserved for read names // (OK) "consed.alignedReadsWindowAutomaticallyExpandRoomForReadNames: true", // If true, expand and contract space for read names, but don't // contract less than consed.alignedReadsWindowMaxCharsForReadNames. // If false, then always use // consed.alignedReadsWindowMaxCharsForReadNames // for space reserved for read names. // (OK) "consed.autoFinishAllowResequencingReadsToExtendContigs: false", // if false, a resequencing read is not called to extend a contig--only // custom primer reads and de novo universal primer reads are called // for this purpose. // (OK) "consed.autoFinishCallHowManyReversesToFlankGaps: 2", // This has two purposes: 1) it specifies how many forward/reverse // pairs should be present for Consed/Autofinish to be certain of the // order/ orientation of two contigs. If there are this many fwd/rev // pairs flanking a gap, Autofinish will print out the contig ends that // flank the gap. 2) If consed.autoFinishCallReversesToFlankGaps is // set to true, and there are less than this many fwd/rev pairs // flanking a gap, Autofinish will suggest additional reverses until // there are this many. // (OK) "consed.autoFinishCloseGaps: true", // this allows you to turn off choosing reads to close gaps // (OK) "consed.autoFinishContinueEvenThoughReadInfoDoesNotMakeSense: false", // this allows you to override the checks that autofinish makes on the // read info, such as checking there are not more than 5 or so reads // from the same subclone template // (OK) "consed.autoFinishCostOfResequencingUniversalPrimerSubcloneReaction: 20.0", // compares universal primer subclone reaction, custom primer subclone // reaction, and custom primer clone reaction to decide which to favor // (OK) "consed.autoFinishCostOfCustomPrimerSubcloneReaction: 60.0", // see above // (OK) "consed.autoFinishCostOfCustomPrimerCloneReaction: 80.0", // see above // (OK) "consed.autoFinishCostOfDeNovoUniversalPrimerSubcloneReaction: 60.0", // cost of reverse where there is only a forward or cost of forward // when there is only a reverse // (OK) "consed.autoFinishCostOfMinilibrary: 500.0", // cost of making a minilibrary (transposon library or shatter library) // from a subclone template // (OK) "consed.autoFinishCoverSingleSubcloneRegions: true", // this allows you to turn off choosing reads to cover single subclone regions // (OK) "consed.autoFinishCoverLowConsensusQualityRegions: true", // this allows you to turn off choosing reads to cover low consensus // quality regions // (OK) "consed.autoFinishDebugUniversalPrimerReadsFile: gordon_debug.txt", // for debugging Autofinish // put a file with this name in the same directory as the ace file // format: // fcalld09 fwd // fgj74f01 rev // (template name) (fwd or rev) // (OK) "consed.autoFinishDebugCustomPrimerReadsFile: debug_custom.txt", // for debugging Autofinish // put a file with this name in the same directory as the ace file // format: // cgggacctgg // (primer in 5' to 3' orientation) // (OK) "consed.autoFinishDoNotAllowSubcloneCustomPrimerReadsCloserThanThisManyBases: 200", // see consed.autoFinishDoNotAllowSubcloneCustomPrimerReadsCloseTogether // (OK) "consed.autoFinishDoNotAllowWholeCloneCustomPrimerReadsCloserThanThisManyBases: 300", // see consed.autoFinishDoNotAllowWholeCloneCustomPrimerReadsCloseTogether // (OK) "consed.autoFinishDoNotFinishWhereTheseTagsAre: doNotFinish editable", // list of tag types separated by spaces. E.g., // doNotFinish repeat // tells autofinish that you are not interested in finishing in this region // (OK) "consed.autoFinishDoNotExtendContigsWhereTheseTagsAre: doNotFinish", // list of tag types separated by spaces. E.g., // doNotFinish repeat // tells autofinish that you do not want to extend the contig near this // tag. If you do not want this feature, just leave the list empty. // (OK) "consed.autoFinishDoNotExtendContigsIfTagsAreThisCloseToContigEnd: 50", // Uses the list from consed.autoFinishDoNotExtendContigsWhereTheseTagsAre // and checks if any of these tags are within this many bases of the end of // the contig. If they are, does not extend the contig. // (OK) "consed.dumpContigOrderAndOrientationInfoToThisFile:", // In the case of Consed (not autofinish or autoPCRAmplify), send the // output to this file rather than stderr. If this name is blank, // continue (in case of consed), to send output to stderr. // (OK) "consed.autoFinishDumpTemplates: false", // for debugging, this allows you to dump all information about the // templates--insert locations // (OK) "consed.autoFinishExcludeContigIfOnlyThisManyReadsOrLess: 10", // (OK) "consed.autoFinishExcludeContigIfDepthOfCoverageGreaterThanThis: 50.0", // To exclude contigs that are probably E. coli contamination // \"depth of coverage\" is defined here to mean the sum of the read // lengths (including low quality ends) divided by the contig length. // (OK) "consed.autoFinishExcludeContigIfThisManyBasesOrLess: 1000", // consed.autoFinishExcludeContigIfTooShort must be set to true for // this to have any effect // (OK) "consed.autoFinishHowManyTemplatesYouIntendToUseForCustomPrimerSubcloneReactions: 3", // this tells autofinish which templates you are planning on using // which is necessary to figure out which regions will still be single // subclone regions // (OK) "consed.primersMinNumberOfTemplatesForPrimers: 1", // if there are fewer templates than this, the primer is rejected // Pat wanted this 70 on May 5, 2000 to allow for 20 bases of poor // quality at beginning of read and then 50 bases for phrap to // assemble together "consed.autoFinishMinBaseOverlapBetweenAReadAndHighQualitySegmentOfConsensus: 70", // when extending the consensus, a read that is too far from the // consensus will not be assembled by phrap with this contig and thus // will not be useful for extending the consensus. This gives the // minimum overlap of a read with the high quality segment of the // consensus. As reads are picked, then additional reads may be picked // further out. // (OK) "consed.autoFinishNumberOfVectorBasesAtBeginningOfAUniveralPrimerRead: 40", // used to figure out where the beginning of a reverse will be. Not // important to be accurate because the insert size is so uncertain // (OK) "consed.autoFinishCDNANotGenomic: false", // If this is set to true, the whole clone is assumed to be cDNA and, // rather than the normal method of detecting the end of the clone, // Autofinish detects the end of the cDNA as follows: // the user is expected to add whole read items of type 'template', // with 'type: univ fwd' for the 5' end and 'type: univ rev' for the 3' // end of the cDNA. // (OK) "consed.autoFinishConfidenceThatReadWillCoverSingleSubcloneRegion: 90", // Autofinish computes the per cent of existing reads are aligned at // each base position. Typically, this number starts at around 0% at // base position 1, rises to close to 100% at around base position 300, // and then drops again to 0% at base position 800 or so. This number // specifies how high the number must be for Autofinish to consider an // Autofinish read to cover a single subclone region. // (OK) "consed.autoFinishPrintForwardOrReverseStrandWhenPrintingSubcloneTemplatesForCustomPrimerReads: true", // If this is true, then custom primer reads are printed out like this: // tccagaaaactaattcaaaataatg,56,standard.2,->,2413,2413,3681,Contig1,9,djs74_690 (fwd),10,djs74_1803 (fwd),11,djs74_1861 (fwd) // If this is false, then custom primer reads are printed out like this: // tccagaaaactaattcaaaataatg,56,standard.2,->,2413,2413,3681,Contig1,9,djs74_690,10,djs74_1803,11,djs74_1861 // The difference is the (fwd) or (rev) that indicates which strand of // the subclone template is to be used. This is particularly important if // you use M13 and thus must make the reverse strand. // (OK) "consed.autoFinishPrintMinilibrariesSummaryFile: false", // If this is true, Autofinish will print a file with name // xxx.minilibraries just as it prints one as xxx.univReverses and // xxx.univForwards // (OK) "consed.autoFinishNearGapsSuggestEachMissingReadOfReadPairs: true", // This is set to true to increase the chance of closing a gap. For // every subclone template that has just one universal primer read // (either just a forward or just a reverse) that might protrude off // the end of the contig, Autofinish suggests the universal primer read // off the opposite end of the subclone template. // If this parameter is set false, then // Autofinish may still choose some of these reads, but it won't // necessarily choose them all. // (OK) "consed.autoFinishDoNotIgnoreLCQIfThisManyBasesFromEndOfContigForLCQTagger: 300", // Do not ignore low consensus quality bases if they are this many // bases from the end of the contig. // (OK) "consed.checkIfTooManyWalks: true", // this just checks if the number of walks, pcr ends, and unknown reads // exceeds 20% of the total number of reads. If this is exceeded, then // a warning message is given. Typically, such a warning indicates // that you have incorrectly customized determineReadTypes.perl // (OK) "consed.numberOfColumnsBeforeReadNameInAlignedReadsWindow: 1", // this is for displaying information about the whole read items, // both from PHD files and from a file "consed.compareContigsAlignsThisManyBasesMax: 2000", // (OK) "consed.compressedChromatExtension: .gz", // (OK) "consed.dimLowQualityEndsOfReads: false", // // (OK) // phil 980713 requested that the default be to not dim // low quality ends of reads and to dim the unaligned ends // of reads "consed.dimUnalignedEndsOfReads: true", // (OK) "consed.fakeReadsSpecifiedByFilenameExtension: true", // if this is true, then reads that end with .a[0-9]* or .c[0-9]* will // be considered fake reads. Otherwise, fake reads will be indicated // by a WR item in the PHD file. // (OK) "consed.fullPathnameOfAddReads2ConsedScript: $CONSED_HOME/bin/addReads2Consed.perl", // (OK) "consed.fullPathnameOfFixContigEndScript: $CONSED_HOME/bin/fixContigEnd.perl", // (OK) "consed.fixContigEndsCleanUpTemporaryFiles: true", // -fixContigEnds leaves behind zillions of temporary files from // phrapping. Delete these (except for debugging). // (OK) "consed.fixContigEndsMinSmithWatermanScoreToMakeJoin: 30", // when making the join, if the smith-waterman score is less // than this, do not make the join and leave the contig-end as is // (NO) "consed.fixContigEndsMinNumberOfReadsInContig: 5", // only fix contigs that have this number of reads or more // (YES) "consed.fullPathnameOfCrossMatch: $CONSED_HOME/bin/cross_match", // (OK) "consed.fullPathnameOfPhred: $CONSED_HOME/bin/phred", // (OK) "consed.fullPathnameOfMiniassemblyScript: $CONSED_HOME/bin/phredPhrap", // If you are up-to-date with phredPhrap, this script serves both // the purpose of assemblying the entire project, as well as making // miniassemblies. The difference is whether phredPhrap has the // -include_chromats option. // (OK) "consed.gunzipFullPath: /bin/gunzip", // (OK) "consed.fullPathnameOfFilter454ReadsScript: $CONSED_HOME/bin/filter454Reads.perl", // Runs crossmatch between the unpaired reads and puc19 to eliminate those // reads contaminated with puc19 // (OK) "consed.filter454ReadsAgainstThis: $CONSED_HOME/lib/screenLibs/filter454Reads.fa", // used by consed.fullPathnameOfFilter454ReadsAgainstVectorScript // (OK) "consed.454LinkerSequences: $CONSED_HOME/lib/screenLibs/sffLinkers.fa", // the linker sequence for paired-end 454 reads used in // sff2PhdBall // (OK) "consed.hideSomeTagTypesAtStartup: false", // (OK) "consed.maximumNumberOfTracesShown: 4", // (OK) "consed.navigateAutomaticTracePopup: false", // (OK) "consed.navigateAutomaticAllTracesPopup: false", // (OK) "consed.primersMinimumLengthOfAPrimer: 15", // (OK) "consed.primersMaximumLengthOfAPrimer: 25", // (OK) "consed.primersMinimumLengthOfAPrimerForPCR: 18", // (OK) "consed.primersMaximumLengthOfAPrimerForPCR: 30", // (OK) "consed.primersMaxMeltingTempDifferenceForPCR: 3.0", // how large can the difference of melting temperatures be between // two primers of a PCR primer pair // (OK) "consed.primersMaxPCRPrimerPairsToDisplay: 100000", // there is a limit here, because there could possibly be millions // (OK) "consed.primersCheckJustSomePCRPrimerPairsRatherThanAll: true", // If there are 1000 1st primers, and 1000 2nd primers, that gives // a million pairs for Consed to check, which takes a long time. So // instead, just check some of the pairs // (OK) "consed.primersNumberOfTemplatesToDisplayInFront: 2", // this shows the number of templates to show in the interactive primer // picking window // (OK) "consed.primersMaxLengthOfMononucleotideRepeat: 4", // (OK) "consed.primersBadLibrariesFile: badLibraries.txt", // file of libraries, one per line // If any template is from any one of these libraries, then // consed/autofinish will not use this template for walking or // suggesting any universal primer reads // (OK) "consed.primersLibrariesInfoFile: librariesInfo.txt", // file of libraries, with one entry for each library of the following // format: // LIB{ // name: library1 // avgInsertSize: 3000 // maxInsertSize: 5000 // stranded: single // cost: 600.0 // } // (OK) "consed.primersBadTemplatesFile: badTemplates.txt", // file of templates that you've tried, don't work, and you don't want to try // again // (OK) "consed.primersChooseTemplatesByPositionInsteadOfQuality: true", // Templates for subclone custom primer walks can be chosen either on // the basis of the quality of the template (as determined by the quality // of existing reads from that template) or by the location of the end of // the template. If this parameter is false, templates will be chosen // based solely on quality. If this parameter is true, then templates // with forward/reverse pairs will be picked first, followed by templates // that have the beginning of the insert closest to the primer. // (OK) "consed.primersWhenChoosingATemplateMinPotentialReadLength: 350", // when choosing templates for a custom primer, only choose a template // if the read can be chosen at least this long // (OK) "consed.primersWindowSizeInLookingForPCR: 2000", // will look this many bases back from the pointer when looking for a PCR // primer. Used both interactively and for Autofinish (see // getUnpaddedRangeForMakingPCRPrimers ) // (OK) "consed.qualityThresholdForFindingHighQualityDiscrepancies: 40", // high quality discrepancies have this quality or higher // (OK) "consed.qualityThresholdForNavigateByDepthOfCoverage: 10", // for high depth of coverage, this is the minimum quality // see consed.navigateByHighDepthOfCoverageNotLow // (OK) "consed.navigateByHighDepthOfCoverageNotLow: true", // see consed.qualityThresholdForNavigateByDepthOfCoverage: // (OK) "consed.MinDepthForNavigateByDepthOfCoverage: 10", // see consed.qualityThresholdForNavigateByDepthOfCoverage: // (OK) "consed.defaultVectorPathnameForRestrictionFragments: $CONSED_HOME/lib/screenLibs/singleVectorForRestrictionDigest.fasta", // If you want to have the vector cut with the restriction // enzymes, put the vector sequence in a file in fasta format // and put a pathname to it here. // (OK) "consed.fileOfAdditionalRestrictionEnzymes: ", // If you want a restriction enzyme that is not in the huge list // that comes with Consed, you can put additional enzymes in a file // and put the full pathname of that file here. The file must be in // the form: // AatI AGGCCT // where AatI is the name of the enzyme and AGGCCT is the recognized // sequence. Do not include the cut site or any other information. // There must be a single space separating them. // (OK) "consed.commonRestrictionEnzymes: BglII EcoRV NsiI HindIII BamHI XhoI PstI", // a space-separated list of enzymes. Make sure they match precisely // those that are either defaults or in the file indicated by // consed.fileOfAdditionalRestrictionEnzymes // (OK) "consed.defaultSelectedRestrictionEnzymes: EcoRV HindIII", // a space-separated list of enzymes that will initially be // selected when the user pops open the list of restriction enzymes. // Currently these must be from among the consed.commonRestrictionEnzymes // (OK) "consed.restrictionEnzymesActualFragmentsFile: fragSizes.txt", // format like this: // >EcoRV // 2385 // 2489 // -1 // >XhoIII // 259 // 3843 // -1 // (OK) "consed.restrictionDigestInitialWindowSizeInTextRows: 45", // (OK) "consed.restrictionDigestDoNoShowAreaOfFragmentsOverThisSize: 50000", // In the picture of the real and in-silico // (OK) "consed.showReadsAlphabetically: false", // (OK) "consed.showReadsInAlignedReadsWindowOrderedByFile: false", // There are now 3 different ways to sort the reads in the Aligned // Reads Window (top to bottom): // 1) alphabetically in which case you should set: // consed.showReadsAlphabetically: true // consed.showReadsInAlignedReadsWindowOrderedByFile: false // 2) by the left end of the reads in which case you should set: // consed.showReadsAlphabetically: false // consed.showReadsInAlignedReadsWindowOrderedByFile: false // 3) by a file that specifies the order of the reads in which case you // should set: // consed.showReadsAlphabetically: false // consed.showReadsInAlignedReadsWindowOrderedByFile: true // It is an error to set: // consed.showReadsAlphabetically: true // consed.showReadsInAlignedReadsWindowOrderedByFile: true // (OK) "consed.showReadsInAlignedReadsWindowOrderedByThisFile: readOrder.txt", // This file has one read name per line. Wildcards ('*') are allowed. // E.g., // ABX* // myFavoriteRead.scf // *.abi // This means that all reads that start with ABX* will come first, // followed by the single read myFavoriteRead.scf and then reads that end // with .abi A read that doesn't meet any of these criteria (e.g., // rs10469282 ) comes last. // (OK) //consed.showReadsSortedByQualityValuesAtCursor: true //bool // deprecated // Note that currently this only applies when the cursor is set // on the consensus position. When scrolling, the reads are // sorted according to consed.showReadsAlphabetically and // consed.showReadsInAlignedReadsWindowOrderedByFile // (OK) "consed.showReadsAtCursorSortedHow: quality", // Note that currently this only applies when the cursor is set // on the consensus position. When scrolling, the reads are // sorted according to consed.showReadsAlphabetically and // consed.showReadsInAlignedReadsWindowOrderedByFile // use the following values: quality, base, none // (OK) "consed.showABIBasesInTraceWindow: false", // (OK) "consed.tracesWindowInitialPixelHeight: 50", // (OK) "consed.assemblyViewWindowInitialPixelHeight: 500", // (OK) "consed.assemblyViewFileOfTemplatesToNotShow: doNotShowInAssemblyView.fof", // (OK) "consed.assemblyViewCrossMatchMinmatch: 30", // value of -minmatch to be passed to crossmatch // (OK) "consed.assemblyViewCrossMatchMinscore: 60", // value of -minscore to be passed to crossmatch // (OK) "consed.assemblyViewFindSequenceMatchesForConsedScript: $CONSED_HOME/bin/findSequenceMatchesForConsed.perl", // script that generates the file that is used by Assembly View to // show sequence matches // (OK) "consed.assemblyViewCrossmatchMinmatch: 50", // default value of -minmatch for running crossmatch with // findSequenceMatchesForConsed.perl // (OK) "consed.assemblyViewCrossmatchMinscore: 50", // default value of -minscore for running crossmatch with // findSequenceMatchesForConsed.perl // (OK) "consed.assemblyViewSequenceMatchesMinimumSimilarity: 90", // only show sequence matches if their simlarity is at least this // value. This can be changed by the user within consed/assembly view/ // by clicking on "What to show/Sequence Matches" // (OK) "consed.tracesWindowInitialPixelWidth: 800", // (OK) "consed.assemblyViewWindowInitialPixelWidth: 800", // (OK) "consed.automaticallyScaleTraces: true", // (OK) "consed.automaticallyScaleTracesSamplePeakHeightFractionOfWindowHeight: 0.99", // (OK) "consed.automaticallyScaleTracesSamplePeakPercentile: 100", // (OK) "consed.verticalTraceMagnification: 30", // (OK) "consed.userDefinedKeys: 14 15", // make a space-separated list of the decimal ASCII values of the keys // 14 means control-N, 15 means control-O // (OK) "consed.programsForUserDefinedKeys: /bin/echo /bin/echo", // a space-separated list of the full pathnames of the commands to run // This goes with consed.userDefinedKeys // (OK) "consed.argumentsToPassToUserDefinedPrograms: argument_for_first_key argument_for_second_key", // a space-separated list of the arguments to pass to the user-defined programs // This goes with consed.userDefinedKeys // (OK) "consed.tagsToApplyWithUserDefinedKeys: none polymorphismConfirmed", // a space-separate list of the tag types to apply when the user // presses a user-defined key. If a key is to have no associated tag, // then enter "none" for that key. // This goes with consed.userDefinedKeys // (OK) "consed.snpGenomeUseInsertionPolymorphisms: true", // used with consed -snpGenome // (OK) "consed.listOfTagTypesToHide: matchElsewhereHighQual matchElsewhereLowQual", // (OK) "consed.listOfOptionalWordsToSaveInListOfReadNames: forward reverse ET BigDye customOligo SeqEx FS dyePrimer dyeTerminator doubleStranded singleStranded", // (OK) "consed.extendConsensusWithHighQuality: false", // When using "change consensus" to extend the consensus, make the // read edited high quality. This will cause phrap, the next time // the project is assembled, to similarly extend the consensus. If // this is set to false, then do not change the quality of the read and // extend the consensus with the original read qualities. // (OK) "consed.fastStartup: true", // If you have used catPhdFiles.perl to create a huge file with all the // xxx.phd.1 files, and you have enough memory on your computer, then // you can startup up consed up to 7 times faster // (OK) "consed.fastStartupFile: phd.ball", // If you have used catPhdFiles.perl to create a huge file with all the // xxx.phd.1 files, and you have enough memory on your computer, then // you can startup up consed up to 7 times faster. This file gives // the name of the huge file. // (OK) "consed.alwaysRunProgramToGetChromats: false", // This allows consed to get chromats out of a database, or do some // other pre-processing of a chromat before reading it. If set to true, // consed does not look in ../chromat_dir at all for the chromat, but // rather runs the program listed in consed.programToRunToGetChromats // with argument name-of-read and then reads the chromat out of // consed.uncompressedChromatDirectory and then later deletes the // chromat from consed.uncompressedChromatDirectory // If set to false, it never does this. If set to "last", it does // this as a last resort. // (OK) "consed.programToRunToGetChromats: /usr/local/bin/myFavoriteProgram", // Set this to the program or script that you want to use to // get a chromat and put it into /tmp (or whatever you set // consed.uncompressedChromatDirectory to) // (OK) "consed.programToRunToGetChromatsOf454Reads: $CONSED_HOME/bin/sff2scf", // This will be run on 454 reads if the read is not found in // chromat_dir. If you don't want this to happen, you can make // this null. // (OK) "consed.createFakeChromatsForSolexaReads: true", // (OK) "consed.autoFinishUseLongModelReadRatherThanShort: false", // When calculating the distribution of quality values at high read // positions, should Autofinish assume that the reads that were this // long and longer are representative of finishing reads, or should it // assume that some finishing will not make it out this far in roughly // the same proportion as the existing reads. // (OK) "consed.askAgainIfWantToQuitConsedIfThisManyReads: 500000", // If you have to wait a long time for consed to come up, don't // quit out of consed by mistake. // (OK) "consed.printWindowInstructions: Make sure that the window you want to print is unobscured. Then click \"Yes\" to dismiss this box. Then click on the window you want to print. You will hear a beep immediately, then another beep a little later. Then the copy of the window should come off the printer specified by your environment variable LPDEST.", // (OK) "consed.allowMultipleSearchForStringWindows: false", // If this is false, and there is already a SearchForString Window up, // and the user clicks on SearchForString, it will be brought to the // front, rather than another one being created. // (OK) "consed.autoPCRAmplifyFalseProductsOKIfLargerThanThis: 3000", // If a pcr primer pair matches somewhere else and creates a product // larger than this, the pcr primer pair will still be acceptable // since the product will not easily form in the cycle time. // (OK) "consed.autoPCRAmplifyMakePrimerOutOfFirstRegion: false", // I don't expect people will use this. It allows you to amplify a // region using autoPCRAmplify not by allowing Consed to choose each // primer (the normal case) but rather by fixing the first primer to be // the first area bordering the region. I added this to allow // non-specific priming to the transplice leader. // (OK) "consed.autoPCRAmplifyMaybeRejectPrimerIfThisCloseToDesiredProduct: 5000", // ---> ---> // false true match // In such a case, the primer pair will be rejected if the false is // within 5000 bases of true, even if false is a false match of the // other primer. // // <--- ---> // false true match // In this case, the primer pair will not be eliminated. // (OK) "consed.addNewReadsRecalculateConsensusQuality: false", // When running consed by // consed -ace old_ace.ace -addReads fileOfPhdFiles.txt -newAceFilename new_ace.ace // consensus quality is recalculated // This also applies to add454Reads.perl and addSolexaReads.perl // (OK) "consed.addNewReadsPutReadIntoItsOwnContig: ifUnaligned", // choices are: // "always" (just put each read into its own contig) // "ifUnaligned" (put read into a contig if it aligns against the // consensus, otherwise put it into its own contig) // "never" (put read into a contig if it aligns against the consensus; // otherwise do not put it into the assembly) // (OK) "consed.addNewReadsCheckThatCrossMatchRunCorrectly: true", // addReads2Consed.perl changed in March 2008 to have -discrep_lists // instead of -alignments. Check that user is using the new // parameters // (OK) "consed.assemblyViewNumberOfRowsOfTags: 4", // (OK) "consed.warnUserWhenTryingToEditAllReads: true", // in the Aligned Reads Window, the user may change all reads at once // to a particular base at a particular position. This is dangerous // and the user is warned. This resource allows the user to suppress // this warning. // (OK) "consed.maybeXKEYSYMDBPath: /usr/share/X11/XKeysymDB", // Fixes a problem in X on some versions of linux giving pages of the // following errors: // Warning: translation table syntax error: Unknown keysym name: osfActivate // (OK) "consed.maybeXKEYSYMDBPath2: /usr/X11R6/lib/X11/XKeysymDB", // Fixes a problem in X on some versions of linux giving pages of the // following errors: // Warning: translation table syntax error: Unknown keysym name: osfActivate // (OK) "consed.amountToMoveWithBigLeftAndRightArrows: 10", // allows user to move on a read in the Aligned Reads Window // by more than 1 base at a time // (OK) "consed.navigateByHighlyDiscrepantPositionsMinDiscrepantReads: 2", // ignores low quality reads // (OK) "consed.navigateByHighlyDiscrepantPositionsMaxDepthOfCoverage: 100000", // (OK) "consed.navigateByHighlyDiscrepantPositionsIgnoreBasesBelowThisQuality: 20", // (OK) "consed.navigateByHighlyDiscrepantPositionsJustListIndels: false", // (OK) "consed.navigateByHighlyDiscrepantPositionsIgnoreOtherReadsStartingAtSameLocation: false", // If there are, for example, 3 reads that all start at the same // location, use only the first and ignore the second and third // (OK) "consed.navigateByHighlyDiscrepantPositionsIgnoreIfListedBasesInConsensus: false", // Do not report this position if there is one of the bases in the consensus // listed in // consed.navigateByHighlyDiscrepantPositionsIgnoreIfTheseBasesInConsensus // (OK) "consed.navigateByHighlyDiscrepantPositionsIgnoreIfTheseBasesInConsensus: xn", // Do not report this position if there is one of these bases in the // consensus and if // consed.navigateByHighlyDiscrepantPositionsIgnoreIfListedBasesInConsensus: // is set to true // (OK) "consed.phdBallDirectory: ../phdball_dir", // phd balls are assumed to be in here. This is typically where consed // starts, but could be relative to that, such as ../phdball_dir // (OK) "consed.newAceFileFOF: newAceFile.fof", // if consed needs to write a new ace file, the name of that is written // to this file // (OK) "consed.navigateByHighOrLowDepthCoalesceRegionsIfThisClose: 50", // for navigate by high or low depth of coverage // (OK) "consed.removeReadsDeleteNotJustPutInOwnContig: true", // used for consed -removeReads and consed -removeContigs // (OK) "consed.paired454LeftReadExtension: _left", // (OK) "consed.paired454RightReadExtension: _right", // (OK) "consed.snpGenome1MSnps: snp1M.txt", // file for development of snpGenome // (OK) "consed.diffChromosomesExcludeDeletions: false", // for testing snpGenome moving deletions // (OK) "consed.snpGenomeFilterByWeight: true", // if true, only considers polymorphisms with soWeight == "1" // (OK) "consed.wantReadsUpToThisFarFromSnps: 50", // for phaster2PhdBall (phaster2Ace.perl ) to take reads, even if they don't overlap the // snp, that are this far away from the snp // (OK) "consed.phaster2PhdBallSaveWhichMate: both", // for phaster2PhdBall (phaster2Ace.perl) to determine whether // the function of just saving the reads that intersect the snp are // saved, or whether both mates of a read pair are saved if either one // intersects the snp location and has one of the desired alleles // alternative: unmapped which says that just the unmapped read is // saved // (OK) "consed.phaster2PhdBallSaveInPhasterFormat: false", // for phaster2PhdBall::maybeSaveBothReads to save the read in // phaster format rather than in phd format. This only applies // if consed.phaster2PhdBallSaveBothMates: is set to true // the phaster lines will be set to the file specified by // -phdBall on the command line // (OK ) "consed.phaster2PhdBallCalculateNewLocationsFile: false", // for phaster2PhdBall. Calculates depth of coverage and // makes new locations that have depth of coverage "consed.phdBall2FastaIgnoreLowQualityReads: false", // for consed -phdBall2Fasta // if a read has mean quality below a threshold, do not // write it to the fasta file // (OK) "consed.phdBall2FastaLowestAverageQuality: 25", // for consed -phdBall2Fasta // if read has mean quality below this, ignore it // (OK) "consed.nextPhredPipelineControlFile: control-file.txt", // (OK) "consed.nextPhredPipelineTiffPerlScript: bin/run_tiff2intens_1_tile.perl", // (OK) "consed.nextPhredPipelinePhasterPerlScript: bin/run_phaster_1_tile.perl", // (OK) "consed.nextPhredPipelineVersion: 100625", // (OK) "consed.nextPhredPipelineMainDirectory: /et/grc/vol3/np_testing/pipeline", // (OK) // // // // parameters in the (NO) category // // "consed.maxNumberOfReadsPerPhdBall: 1000000", // This is important since cross_match slows down on fasta files of // over a few million reads // (NO) "consed.userWantsToSaveToThisAceFile:", // (NO) "consed.autoFinishEmulate9_66Behavior: false", // Picks univ primer reads and walks in the same phase. This results // in poor redundancy of universal primer reads, may pick custom primer // reads over universal primer reads, but may pick fewer // reads overall. // (NO) "consed.primersPCRPrimersGroupedIntoWindowOfThisManyBases: 200", // to speed up PCR primer picking and to reduce the number of // PCR primer pairs, group primers into windows of this size // and then just compare window against window // (NO) "consed.primersLookForThisManyPCRPrimerPairsPerPairOfGroups: 2", // to speed up PCR primer picking and to reduce the number of PCr // primer pairs, group primers into windows and then just accept // this many primer pairs from a pair of groups // (NO) "consed.autoFinishStandardDeviationsFromMeanFromGapToLookForTemplatesForSuggestingEachMissingReadOfReadPairs: -1.0", // Only applies when consed.autoFinishNearGapsSuggestEachMissingReadOfReadPairs: // is set to true. If m is the mean insert size and d is the standard // deviation and this parameter is p, then consider all templates // within a distance m + p*d from the gap. // (NO) "consed.autoFinishCheckThatReadsFromTheSameTemplateAreConsistent: true", // I strongly advise keeping this true. If you change it to false, you // are on your own. If the forward and reverse universal primer reads // look like this: <--- ---->, how is autofinish going // to even know where the template is, huh? Leave it true! // (NO) "consed.autoFinishDoNotAllowSubcloneCustomPrimerReadsCloseTogether: true", // at higher redundancy, autofinish may pick custom primer reactions // that are only a few bases apart on the same strand. This parameter, // along with // consed.autoFinishDoNotAllowSubcloneCustomPrimerReadsCloserThanThisManyBases, // says how far apart they can be // (NO) "consed.autoFinishDoNotAllowWholeCloneCustomPrimerReadsCloseTogether: true", // Even at redundancy 1, Autofinish may pick whole clone reads just // a few bases apart. This prevents it. // (NO) "consed.autoFinishMinilibrariesPreferTemplateIfSizeThisManyStdDevsFromMean: 2.0", // If a template is more than this many standard deviations from the // mean, try to avoid using it, unless there is nothing else. // Rationale: there is something wrong with this template--an insertion // or deletion. // (NO) "consed.autoFinishMinNumberOfForwardReversePairsInLibraryToCalculateAverageInsertSize: 5", // If there are at least this many fwd/rev pairs in a library, then // the mean and standard deviation are used for sizing other templates in // the same library. If there are fewer than this, then the default size // specified in the librariesInfo.txt file is used. // (NO) "consed.autoFinishIfEnoughFwdRevPairsUseThisManyStdDevBelowMeanForInsertSize: 0.2", // If you are interested in walking on a template that does not have a // forward/reverse pair, then the precise insert size is uncertain. If // this template comes from a library that has lots of templates with // forward/reverse pairs, then the mean and standard deviation of the // insert sizes from this library is known. For the template in // question, we could just use the mean of this library (this parameter = // 0.0), but we could be conservative and assume the insert size is // somewhat less. This parameter tells how much less. // (NO) "consed.autoFinishNewCustomPrimerReadThisFarFromOldCustomPrimerRead: 50", // this tells autofinish when it wants to make a new custom primer // read, how far this read must be from any previous custom primer // reads on the same strand // (NO) "consed.autoFinishMinNumberOfSingleSubcloneBasesFixedByAnExp: 1", // if an experiment will only fix less than this number of single // subclone bases, don't do it even if the total number of single // subclone bases in the contig is too high // (NO) "consed.autoFinishNumberOfBasesBetweenContigsAssumed: 1000", // gap size--each base in the gap counts as 1 error so autofinish tries // to extend into gaps // (NO) "consed.autoFinishPotentialHighQualityPartOfReadStart: 80", // Phil and Kerrie both suggested upping this from 50 // on March 25, 1999 // nReadUnpaddedConsPosStart + nAutoFinishPotentialHighQualityPartOfReadStart_ // == nReadUnpaddedConsPosStartOfPotentialHighQuality // this is used to evaluate the quality of templates // this no longer has much effect on the reads autofinish chooses // (NO) "consed.autoFinishPotentialHighQualityPartOfReadEnd: 300", // nReadUnpaddedConsPosStart + nAutoFinishPotentialHighQualityPartOfReadEnd_ // == nReadUnpaddedConsPosEndOfPotentialHighQuality // this is used to evaluate the quality of templates // this no longer has much effect on the reads autofinish chooses // (NO) "consed.autoFinishPrintCustomNavigationFileForChosenReads: true", // If this is true, then autofinish will print a file of the chosen reads // in the format for consed to navigate (prev and next) to each // location of the proposed new reads // (NO) "consed.autoFinishReversesForFlankingGapsTemplateMustProtrudeFromContigThisMuch: 100", // Normal case: // --------------------------- (consensus) // ----------- template1 // ----------- template2 // ----------- template3 // Then you probably would want to use template3 since a reverse is // most likely to go in the other contig rather than go into gap. // But suppose that template2 and template3 don't exist. Would you // want to use template1? This parameter tells Autofinish whether you // would want to use it, or pick no reverse at all. // (NO) "consed.autoFinishTagOligosWhenDoExperiments: true", // when autofinish is run with -doExperiments, tags the oligos // it chooses // (NO) "consed.countPads: false", // (NO) "consed.debugging: 0", // for consed development use // (NO) "consed.debugging2: 0", // for consed development use // (NO) "consed.debugging3: 0", // for consed development use // (NO) "consed.debuggingString: joseph", // for consed development use // (NO) "consed.ignoreHighQualityDiscrepanciesThisManyBasesFromEndOfAlignedRegion: 5", // Phil specified this (changed from 10) on 6/30/98 "consed.ignoreUnalignedHighQualitySegmentsShorterThanThis: 20", // (NO) "consed.primersLookThisFarForForwardVectorInsertJunction: 125", // don't change this--if no X's this far from beginning of read, then // assume that you are in insert // (NO) "consed.primersDNAConcentrationNanomolar: 50.0", // used for melting temperature--don't change this! // (NO) "consed.primersMaxMatchElsewhereScore: 17", // used for testing false-annealing to template and to vector // (NO) "consed.primersMaxMatchElsewhereScoreForPCR: 21", // used for testing false-annealing to template and to vector // when used with PCR // (NO) "consed.primersMaxSelfMatchScore: 6", // cutoff for self-annealing of a primer // (NO) "consed.primersMaxPrimerDimerScoreForPCR: 14", // careful changing this // (NO) "consed.primersMinQuality: 30", // you must be sure of the sequence of a primer or it won't anneal to // where you want // (NO) "consed.primersPrintInfoOnRejectedTemplates: true", // whether to print which templates were rejected and why (this output // can be large ) // (NO) "consed.primersSaltConcentrationMillimolar: 50.0", // used for melting temperature--don't change this! // (NO) "consed.primersScreenForVector: true", // whether or not to screen primers for annealing to vector // (NO) "consed.primersToleranceForDifferentBeginningLocationOfUniversalPrimerReads: 100", // different forward reads or different reverse reads // can differ by up to this amount in the starting location // If they differ by more, then there is something wrong // with the template (it is mislabeled?) so don't use it again for // walking // (NO) "consed.primersTooManyVectorBasesInWalkingRead: 10", // if there are this many x's, then don't walk again on this template // (NO) "consed.qualityThresholdForLowConsensusQuality: 25", // Phil had this changed from 20 to 25 on 15 Jul 98 // highest low quality. A base at this quality is considered low // quality. A base higher than this is considered high quality. // (NO) "consed.tagColorPerCentOfBase: 50", // (NO) "consed.uncompressedChromatDirectory: /tmp", // (NO) "consed.454sff2scfDirectory: /tmp", // when a user asks to see a 454 trace, and sff2scf runs, the // scf file will be put here. This is hard-coded in sff2scf.c // (NO) "consed.whenMakingFakeReadToJoinContigsAddThisManyBasesOnEitherSideOfAlignedRegion: 200", // (NO) "consed.writeThisAceFormat: 2", // (NO) "consed.dumpCoreIfBoundsError: false", // (NO) "consed.autoFinishMinSmithWatermanScoreOfARun: 20", // (NO) "consed.autoFinishDoNotComparePCRPrimersMoreThanThisManyTimes: 1.0e+9", // When autofinish tries to find a compatible set of pcr primers, it // can take billions of tries. This limits the number of tries so that, // if autofinish can't find it in this number of tries, it gives up // rather than running for days, weeks, years! // (NO) "consed.restrictionDigestMaximumBasesToCompareToVector: 200", // (NO) "consed.restrictionDigestZoomFactor: 2.0", // Amount to zoom in or out in the gel window of the restriction digest // (NO) "consed.restrictionDigestZoomFactorForNavigate: 10.0", // When looking at restriction gel and navigating to first problem // location, this is the amount to zoom in. // (NO) "consed.restrictionDigestToleranceInPositionUnits: 20", // (NO) "consed.autoPCRAmplifyTooManySeriousFalseMatches: 100", // If a pcr primer pair has a significant false match to this many // other places in the assembly, do not consider for possible pcr // primer pairs. This is just for the purpose of speeding up picking // of primer pairs--the higher the number, the faster the searching, // but the more likely a primer pair will be selected that will // create multiple products. // (NO) "consed.assemblyViewZoomFactor: 1.5", // amount to zoom in or out // (NO) "consed.assemblyViewFilterInconsistentFwdRevPairsIfThisClose: 2000", // If forward/reverse pairs start this close together and end this // close together, they confirm each other. // (NO) "consed.assemblyViewGridCellWidthInPixels: 4.0", // for keeping track where objects are on screen. If you make it // larger, you get better drawing performance, but lower resolution // of which objects the cursor is pointing at // (NO) "consed.assemblyViewCursorSensitivityInPixels: 4", // square about cursor that will detect objects // (NO) "consed.assemblyViewReadDepthQuality: 20", // (NO) "consed.showAllTracesMaxNumberOfTracesToShowAtOnce: 100", // (NO) "consed.allowFwdRevPairScaffoldsToBeMergedIfThisManyBasesIntersectionOrLess: 1000", // (NO) "consed.justForPrimateProject: false", // (NO) "consed.solexaFilesAreAssumedToBeHere: ../solexa_dir", // any solexa files (or links) are assumed to be in this directory. // If you change this, it can have effects in 3 places: 1) add new // reads list of solexa files 2) add new reads where it looks for these // files and 3) subsequent runs of consed it will prepend this to the // path it finds in the ace file under PHD_DIR: on the DS line. There // may be other implications as well. // (NO) "consed.solexaAlignmentFilesPerInsertingPadsCycle: 50", // (NO) "consed.solexaAlignmentsPerAlignmentFile: 10000", // (NO) "consed.solexaFastqFilesArePhredQualityNotSolexaQuality: true", // (NO) "consed.solexa64FastqOrSanger33Fastq: auto", // valid values are: auto (it figures it out itself), // solexa64 (+64), and sanger33 (+33) // If consed is being fooled, you can set these to force // consed to override what the file appears to be. // (NO) "consed.maximumReadsInReadList: 200000", // even if there are millions of reads, don't display them all or // it will eat up memory and time // (NO) "consed.maxLengthOfReadsInapLocatedFragment2: 10000", // (NO) "consed.maximumStartupErrorsToReport: 50", // (NO) "consed.454LinkerAlignmentMatchScore: 1", // (NO) "consed.454LinkerAlignmentMismatchScore: 3", // (NO) "consed.454LinkerAlignmentIndelScore: 2", // (NO) "consed.filter454ReadsDeleteCrossMatchOutput: true", // This should be changed to false only for troubleshooting. // Otherwise unused files will accumulate on your disk. // (NO) // removed Oct 11, 2010 when removed old method of extending contig ends // when adding new reads //consed.addNewReadsAdditionalConsensusBasesBeyondReads: 500 //int // These additional consensus bases are added for the miniassembly // of the reads on the end of the contig. // (NO) // Resources here are just those for Green Lab research and have // no effect on any Consed/Autofinish/AutoReport functions "consed.autoReportAllNeededSpeciesCode: 1", // if 1, then require PPan|PTro, GGor, PPyg|MMul // if 2, then require PTro, GGor, PPyg, MMul // if 3, then require PTro, GGor, PPyg|MMul // (GREEN LAB) "consed.autoReportUseCommasInBigNumbers: true", // (GREEN LAB) "consed.autoReportPrintToCompareToReich: false", // (GREEN LAB) "consed.autoReportOnlyAllowSitesThatAreBetweenAcceptableSites: false", // in applyFilters. This will guarantee that we can find // deamination mutations. // (GREEN LAB) "consed.autoReportDeaminationMutationsDeterminedByMoreAccurateMethod: true", // in checkTreesAndRecordDeaminationMutations // whether it uses PPan, GGor, and PPyg as well, or just human, PTro, and MMul // This helps for comparison with the whole genome analysis which just // had PTro, HSap, and MMul // (GREEN LAB) "consed.autoReportChooseTreesUsingBadData: true", // in applyFilters // (GREEN LAB) "consed.autoReportChooseTreesByCountingDeaminationMutations: true", // in applyFilters // (GREEN LAB) "consed.autoReportChooseTreesUsingKimura: true", // in applyFilters // (GREEN LAB) "consed.autoReportPrintCrudeChimpHumanMutations: false", // (GREEN LAB) "consed.autoReportPrintPositionsForGraham: false", // used with printFlankedColumns4 // (GREEN LAB) "consed.autoReportPrintAncestralCpGs: false", // used with printFlankedColumns4 // (GREEN LAB) "consed.autoReportPrintCpGMutations: false", // used with printFlankedColumns4 // (GREEN LAB) "consed.autoReportPrintMutationsWithContext: false", // print columns that have mutations with flanking // columns that are conserved //(GREEN LAB) "consed.autoReportCountAllMutationsML: false", // counts all types of mutations and uses trees // based on the probability of each tree //(GREEN LAB) "consed.autoReportCountAllMutations: false", // counts deamination mutations in pairs of columns that // both pass filters. //(GREEN LAB) "consed.autoReportIgnoreMultipleTrees: false", // used with // consed.autoReportCountAllMutations: false // (GREEN LAB) "consed.autoReportCountAcceptableColumnsWithNoneOnLeft: false", // count columns that pass all filters, but column to left of it // doesn't pass all filters // (GREEN LAB) "consed.autoReportPrintFlankedColumns4: false", // This differs from that below primarily in that it // identifies deamination mutationsx // (GREEN LAB) "consed.autoReportUseAnnotationFormat: false", // Used with consed.autoReportPrintFlankedColumns4: // to print things out in a format that can be used for distinguishing // the clades // (GREEN LAB) "consed.autoReportPrintFlankedColumns3: false", // This differs from that below primarily in that it // uses n instead of ? and prints trees // (GREEN LAB) "consed.autoReportPrintFlankedColumns2: false", // This differs from that below primarily in that it // doesn't require all species, but rather // PPan | PTro && GGor && MMul | PPyg // (GREEN LAB) "consed.autoReportPrintFlankedColumns: false", // (GREEN LAB) "consed.autoReportHighQualitySegmentData: false", // (GREEN LAB) "consed.autoReportGoodReadsBug: false", // (GREEN LAB) "consed.autoReportDiscrepancyRateInFlankedRegions: false", // (GREEN LAB) "consed.autoReportDiscrepancyRateInFlankedRegions2: false", // (GREEN LAB) "consed.autoReportDiscrepancyRateInFlankedRegions4: false", // (GREEN LAB) "consed.autoReportDiscrepancyRateInFlankedRegions5: false", // (GREEN LAB) "consed.autoReportSingleSignalOrQuality: false", // (GREEN LAB) "consed.autoReportLowQualityBasesInHQS: false", // (GREEN LAB) "consed.autoReportCompareHQSWithLQS: false", // (GREEN LAB) "consed.autoReportCountColumnsForGroupsOfSpecies: false", // (GREEN LAB) "consed.autoReportSingleSignalInfo: false", // (GREEN LAB) "consed.autoReportSingleSignalInfo2: false", // Just used to print out the # of bases at each quality that are // single signal and the # that are multiple signal. For comparing // 2004 reads with 2005 reads // (GREEN LAB) "consed.autoReportCompareTopAndBottomStrands: false", // (GREEN LAB) "consed.autoReportCompareTopAndBottomStrandsNoHuman: false", // (GREEN LAB) "consed.autoReportCompareTopAndBottomStrands2: false", // (GREEN LAB) "consed.autoReportCompareTopAndBottomStrands3: false", // (GREEN LAB) "consed.autoReportCompareTopAndBottomStrands4: false", // (GREEN LAB) "consed.autoReportTopStrandPinnedPosition: 0", // for use with consed.autoReportCompareTopAndBottomStrands // given in unpadded read pos in direction of sequencing // (GREEN LAB) "consed.autoReportBottomStrandPinnedPosition: 0", // for use with consed.autoReportCompareTopAndBottomStrands // given in unpadded read pos in direction of sequencing // (GREEN LAB) "consed.autoReportCompareTopAndBottomStrandsWithHuman: false", // (GREEN LAB) "consed.autoReportPrintLengthsOfAlignedSegmentsOfReads: false", // (GREEN LAB) "consed.autoReportPrintLengthsOfUnalignedHighQualitySegmentsOfReads: false", // (GREEN LAB) "consed.autoReportPrintIfReadsAreCorrectlyAligned: false", // make sure that .f reads are top strand and .r reads are bottom // strand (Note: this only is true in some projects.) // (GREEN LAB) "consed.autoReportCalculateErrorProbabilitiesByComparingPTroPPan: false", // (GREEN LAB) "consed.autoReportPrintAgreeDisagreeBetweenPairsOfSpecies: false", // (GREEN LAB) "consed.autoReportPrintAgreeDisagreeBetweenPairsOfSpecies2: false", // differs from above in that one or the other of the species bases // must be at least quality 45 // (GREEN LAB) "consed.autoReportFilterSingleSignal: true", // Green 2004 data should not be filtered for single signal // Green 2005 data should be // (GREEN LAB) "consed.autoReportGoodHitReads: /me2/gordon/primates/checkHumanGenomeBothYears/goodReadsBothYears.txt", // (GREEN LAB) "consed.autoReportQualityWindowLow: 10", // (GREEN LAB) "consed.autoReportQualityWindowHigh: 15", // (GREEN LAB) "consed.autoReportPrintNumberOfIsolatedPadsForEachSpecies: false", // (GREEN LAB) "consed.autoReportPrintNumberOfIsolatedPads: false", // (GREEN LAB) "consed.autoReportIsolatedPadsOfReadsWithThisPattern: PTro", // (GREEN LAB) "consed.autoReportMinNumberOfPerfectlyAlignedBasesBeforeDiscrepancy: 5", // (GREEN LAB) "consed.autoReportMaxSizeOfDiscrepantRegion: 3", // used for printing bases of a discrepant region // (GREEN LAB) "consed.autoReportSizeOfDiscrepantRegion: 1", // size of region between the flanking agreeing region // duplicates parameter above // (GREEN LAB) "consed.autoReportPrintMinimumQualityHistogram: false", // (GREEN LAB) "consed.autoReportPrintDiscrepantRegions: false", // (GREEN LAB) "consed.autoReportPrintBasesInDiscrepantRegions: false", // (GREEN LAB) "consed.autoReportPrintDiscrepantRegionsButIgnoreReadsContainingThis: ", // (GREEN LAB) "consed.autoReportBackboneReadHasThisStringInIt: HSap", // (GREEN LAB) "consed.autoReportPrintDiscrepantRegionsButOnlyIfAboveQualityThreshold: false", // if true, // uses consed.qualityThresholdForFindingHighQualityDiscrepancies // (GREEN LAB) "consed.autoReportPrintSpeciesAlignment: false", // (GREEN LAB) "consed.autoReportPrintReadAlignment: false", // This differs from consed.autoReportPrintSpeciesAlignment in that // reads that are for the same species are not combined. (This may be // useful for labs other than the Green Lab.) // (GREEN LAB) "consed.autoReportPrintTheseReads: readsToPrint.txt", // for consed.autoReportPrintReadAlignment // (GREEN LAB) "consed.autoReportPrintReadPositions: false", // use with consed.autoReportPrintSpeciesAlignment: // (GREEN LAB) "consed.autoReportPrintChosenReadName: false", // use with consed.autoReportPrintSpeciesAlignment: // (GREEN LAB) "consed.autoReportNumbersOfCharactersOfChosenReadNameToBePrinted: 1", // if the read name is larger than this, will print this number // of characters at the end of the name. If the read name is shorter, // will just print the read name. // (GREEN LAB) "consed.autoReportPrefix: 1", // normally this will be the chromosome # // (GREEN LAB) "consed.autoReportUseOldCriteriaForDeletingColumnsOfPads: false", // I think: // old: delete column of pads unless there is a certain non-pad (single // signal, high quality, hqs, good hit read), aggressive method // new: delete column of pads only if all combined reads are certain // pads (high quality, high quality segment, single signal, good hit) // conservative method // (GREEN LAB) "consed.autoReportDeleteColumnsOfPadsBeforeAdjustingReadQualityValues: true", // (GREEN LAB) "consed.autoReportFlankingBasesMustBeSingleSignal: false", // for use with consed.autoReportPrintMutationsWithContext: // and others // (GREEN LAB) "consed.autoReportMinimumQualityOfFlankingBases: 0", // for use with consed.autoReportPrintMutationsWithContext: // and others // (GREEN LAB) "consed.autoReportFlankingBasesMustBeInHighQualitySegment: false", // (GREEN LAB) "consed.autoReportSpecies: PPan PTro GGor PPyg MMul", // These must match primateSpecies.h constants // nPPan, nPTro, nGGor, nPPyg, and nMMul // (GREEN LAB) NULL // list is null terminated }; #endif