Score E
Sequences producing significant alignments: (bits) Value
gb|G26684|G26684 human STS STS_D11570. >gi|1375195|gb|G2694... 517 e-146
dbj|AU026763.1|AU026763 Rattus norvegicus, OTSUKA clone, OT... 32 1.7
gb|G55508.1|G55508 SHGC-100856 Human Homo sapiens STS genom... 32 1.7
gb|G03725|G03725 human STS WI-344. 32 1.7
gb|G26684|G26684 human STS STS_D11570. >gi|1375195|gb|G26945|G26945 human STS
SHGC-32699.
Length = 285
Score = 517 bits (261), Expect = e-146
Identities = 285/285 (100%)
Strand = Plus / Plus
Query: 1 gatccctacccttnccgttggtctctntcgctgactcgaggcacctaacatccattcaca 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 gatccctacccttnccgttggtctctntcgctgactcgaggcacctaacatccattcaca 60
Query: 61 cccaacacaggccagcgacttctggggctcagccacagacatggtttgtnactnttgagc 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 cccaacacaggccagcgacttctggggctcagccacagacatggtttgtnactnttgagc 120
Query: 121 ttctgttcctagagaatcctagaggcttgattggcccaggctgctgtntgtnctggaggc 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 ttctgttcctagagaatcctagaggcttgattggcccaggctgctgtntgtnctggaggc 180
Query: 181 aaagaatccctacctcctaggggtgaaaggaaatnaaaatggaaagttcttgtagcgcaa 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 aaagaatccctacctcctaggggtgaaaggaaatnaaaatggaaagttcttgtagcgcaa 240
Query: 241 ggcctgacatgggtagctgctcaataaatgctagtntgttatttc 285
|||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 ggcctgacatgggtagctgctcaataaatgctagtntgttatttc 285
dbj|AU026763.1|AU026763 Rattus norvegicus, OTSUKA clone, OT33.16/752f07, microsatellite
sequence, sequence tagged site
Length = 307
Score = 32.2 bits (16), Expect = 1.7
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 221 ggaaagttcttgtagc 236
||||||||||||||||
Sbjct: 32 ggaaagttcttgtagc 47
gb|G55508.1|G55508 SHGC-100856 Human Homo sapiens STS genomic, sequence tagged site
Length = 711
Score = 32.2 bits (16), Expect = 1.7
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 210 gaaatnaaaatggaaagtt 228
||||| |||||||||||||
Sbjct: 588 gaaataaaaatggaaagtt 606
gb|G03725|G03725 human STS WI-344.
Length = 246
Score = 32.2 bits (16), Expect = 1.7
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 260 ctcaataaatgctagt 275
||||||||||||||||
Sbjct: 178 ctcaataaatgctagt 163
Database: Non-redundant Database of GenBank STS Division
Posted date: Dec 18, 1999 7:45 PM
Number of letters in database: 32,867,852
Number of sequences in database: 89,405
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3932
Number of Sequences: 89405
Number of extensions: 3932
Number of successful extensions: 1177
Number of sequences better than 10.0: 4
length of query: 285
length of database: 32,867,852
effective HSP length: 17
effective length of query: 268
effective length of database: 31,347,967
effective search space: 8401255156
effective search space used: 8401255156
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 10 (19.8 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)