gb|G24969|G24969 human STS EST21946. >gi|1375315|gb|G27065|G27065 human STS
SHGC-31731.
Length = 331
Score = 656 bits (331), Expect = 0.0
Identities = 331/331 (100%)
Strand = Plus / Plus
Query: 1 cctccaccctctcatgagcaacaggatatgtgaaagtacttgcagccagaagcaaaacca 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 cctccaccctctcatgagcaacaggatatgtgaaagtacttgcagccagaagcaaaacca 60
Query: 61 caatcctcgggtgctagatggagctccccaaggagcagagaggaaaaggcaggaggagag 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 caatcctcgggtgctagatggagctccccaaggagcagagaggaaaaggcaggaggagag 120
Query: 121 ggccaggcagcagggatggagactaagtttggcccaaggctgcccgcaagcactgatgcc 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 ggccaggcagcagggatggagactaagtttggcccaaggctgcccgcaagcactgatgcc 180
Query: 181 atcatgccctctggtaggtgtctatttctgtctgaaccagaaatacaccaagctccacac 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 atcatgccctctggtaggtgtctatttctgtctgaaccagaaatacaccaagctccacac 240
Query: 241 atgggggctttgctggcttcgacatcactggttcaactatgtcactgctttgttatattt 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 atgggggctttgctggcttcgacatcactggttcaactatgtcactgctttgttatattt 300
Query: 301 agtgctccagaacctcaggttccttcagatt 331
|||||||||||||||||||||||||||||||
Sbjct: 301 agtgctccagaacctcaggttccttcagatt 331
emb|AL010115|HSPE77H4 H.sapiens flow-sorted chromosome 1 HindIII fragment, SC1pE77H4,
sequence tagged site [Homo sapiens]
Length = 554
Score = 34.2 bits (17), Expect = 0.50
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 123 ccaggcagcagggatgg 139
|||||||||||||||||
Sbjct: 434 ccaggcagcagggatgg 418
gb|G49267.1|G49267 stbK343C1_96809 chromosome 22 genomic clone Homo sapiens STS
genomic clone 343C1, sequence tagged site
Length = 360
Score = 32.2 bits (16), Expect = 2.0
Identities = 22/24 (91%)
Strand = Plus / Minus
Query: 112 ggaggagagggccaggcagcaggg 135
||||||||||| | ||||||||||
Sbjct: 287 ggaggagaggggctggcagcaggg 264
gb|G47248.1|G47248 Z17392_1 Zebrafish AB Danio rerio STS genomic clone Z17392 5',
sequence tagged site
Length = 454
Score = 32.2 bits (16), Expect = 2.0
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 48 agaagcaaaaccacaa 63
||||||||||||||||
Sbjct: 434 agaagcaaaaccacaa 449
gb|G55412.1|G55412 SHGC-100745 Human Homo sapiens STS genomic, sequence tagged site
Length = 652
Score = 32.2 bits (16), Expect = 2.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 99 agaggaaaaggcagga 114
||||||||||||||||
Sbjct: 431 agaggaaaaggcagga 416
emb|Z53965|HSC009WH1 H.sapiens (D2S2321) DNA segment containing (CA) repeat; clone
AFMc009wh1; single read, sequence tagged site [Homo
sapiens]
Length = 382
Score = 32.2 bits (16), Expect = 2.0
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 97 agagaggaaaaggcag 112
||||||||||||||||
Sbjct: 107 agagaggaaaaggcag 122
gb|G08807|G08807 human STS CHLC.GATA70E11.P18111 clone GATA70E11
Length = 643
Score = 32.2 bits (16), Expect = 2.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 100 gaggaaaaggcaggag 115
||||||||||||||||
Sbjct: 482 gaggaaaaggcaggag 467
gb|G21813|G21813 human STS WI-12408.
Length = 418
Score = 32.2 bits (16), Expect = 2.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 47 cagaagcaaaaccaca 62
||||||||||||||||
Sbjct: 193 cagaagcaaaaccaca 178
gb|G02824|G02824 human STS WI-1312.
Length = 349
Score = 32.2 bits (16), Expect = 2.0
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 286 tgctttgttatattta 301
||||||||||||||||
Sbjct: 111 tgctttgttatattta 126
Database: Non-redundant Database of GenBank STS Division
Posted date: Dec 18, 1999 7:45 PM
Number of letters in database: 32,867,852
Number of sequences in database: 89,405
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7042
Number of Sequences: 89405
Number of extensions: 7042
Number of successful extensions: 1951
Number of sequences better than 10.0: 13
length of query: 331
length of database: 32,867,852
effective HSP length: 17
effective length of query: 314
effective length of database: 31,347,967
effective search space: 9843261638
effective search space used: 9843261638
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 10 (19.8 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)