#!/usr/bin/env python # Copyright (c) 2006, The Regents of the University of California, through # Lawrence Berkeley National Laboratory (subject to receipt of any required # approvals from the U.S. Dept. of Energy). All rights reserved. # This software is distributed under the new BSD Open Source License. # # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are met: # # (1) Redistributions of source code must retain the above copyright notice, # this list of conditions and the following disclaimer. # # (2) Redistributions in binary form must reproduce the above copyright # notice, this list of conditions and the following disclaimer in the # documentation and or other materials provided with the distribution. # # (3) Neither the name of the University of California, Lawrence Berkeley # National Laboratory, U.S. Dept. of Energy nor the names of its contributors # may be used to endorse or promote products derived from this software # without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" # AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE # IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE # ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE # LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR # CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF # SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS # INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN # CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) # ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE # POSSIBILITY OF SUCH DAMAGE. from corebio import * from corebio.seq import * from corebio.seq_io import * from test_corebio import * from corebio.seq_io import phylip_io from corebio._py3k import StringIO import unittest class test_phylip_io(unittest.TestCase) : def test_read(self) : f = testdata_stream("phylip_test_1.phy") seqs = phylip_io.read(f) #print seqs self.assertEqual(len(seqs), 10) self.assertEqual(seqs[0].name, "Cow") self.assertEqual(len(seqs[1]), 234) f.close() def test_parse_plain_fail(self) : # should fail with parse error f = StringIO(plain_io.example) self.assertRaises(ValueError, phylip_io.read, f ) def test_parse_phylip_test_2(self): f = testdata_stream('phylip_test_2.phy') seqs = phylip_io.read(f) self.assertEqual(len(seqs), 6) self.assertEqual(len(seqs[0]), 20) self.assertEqual(str(seqs[1]), "CGTTACTCGTTGTCGTTACT") self.assertEqual(seqs[1].name, "Hesperorni") f.close() def test_parse_clustal_fail(self) : # should fail with parse error f = StringIO(clustal_io.example) self.assertRaises(ValueError, phylip_io.read, f , protein_alphabet ) def test_parse_phylip_test_3(self): f = testdata_stream('phylip_test_3.phy') seqs = phylip_io.read(f) self.assertEqual(len(seqs), 6) self.assertEqual(len(seqs[0]), 20) self.assertEqual(str(seqs[1]), "CGTTACTCGTTGTCGTTACT") self.assertEqual(seqs[1].name, "Hesperorni") f.close() def test_parse_phylip_test_4(self): f = testdata_stream('phylip_test_4.phy') seqs = phylip_io.read(f) self.assertEqual(len(seqs), 6) self.assertEqual(len(seqs[0]), 25) self.assertEqual(str(seqs[1]), "GTGGTGGTGGGCGCCGGCCGTGTGG") self.assertEqual(seqs[2].name, "ddrasa") f.close() def test_parse_phylip_test_5(self): f = testdata_stream('phylip_test_5.phy') seqs = phylip_io.read(f) self.assertEqual(len(seqs), 6) self.assertEqual(len(seqs[0]), 50) self.assertEqual(str(seqs[1]), "GTGGTGGTGGGCGCCGGCCGTGTGGGTGGTGGTGGGCGCCGGCCGTGTGG") self.assertEqual(seqs[2].name, "ddrasa") f.close() def test_parse_wrong_phylip_codes_1(self): f = testdata_stream('phylip_test_6.corrupt.phy') self.assertRaises(ValueError, phylip_io.read, f , protein_alphabet ) f.close() def test_parse_wrong_phylip_codes_2(self): f = testdata_stream('phylip_test_7.corrupt.phy') self.assertRaises(ValueError, phylip_io.read, f , protein_alphabet ) f.close() def test_parse_phylip_dna(self): f = testdata_stream('dna.phy') seqs = phylip_io.read(f) self.assertEqual(len(seqs), 10) self.assertEqual(len(seqs[0]), 705) self.assertEqual( str(seqs[1][0:10]), "ATGGCACACC") self.assertEqual(seqs[2].name, "Chicken") f.close() if __name__ == '__main__': unittest.main()