# Copyright 2012 by Wibowo Arindrarto. All rights reserved. # This code is part of the Biopython distribution and governed by its # license. Please see the LICENSE file that should have been included # as part of this package. """Bio.SearchIO objects to model high scoring regions between query and hit.""" from __future__ import print_function from Bio._py3k import basestring import warnings from operator import ge, le from Bio import BiopythonWarning from Bio.Align import MultipleSeqAlignment from Bio.Alphabet import single_letter_alphabet from Bio.Seq import Seq from Bio.SeqRecord import SeqRecord from Bio._utils import getattr_str, trim_str from Bio.SearchIO._utils import singleitem, allitems, fullcascade, \ fragcascade from ._base import _BaseHSP class HSP(_BaseHSP): """Class representing high-scoring region(s) between query and hit. HSP (high-scoring pair) objects are contained by Hit objects (see Hit). In most cases, HSP objects store the bulk of the statistics and results (e.g. e-value, bitscores, query sequence, etc.) produced by a search program. Depending on the search output file format, a given HSP will contain one or more HSPFragment object(s). Examples of search programs that produce HSP with one HSPFragments are BLAST, HMMER, and FASTA. Other programs such as BLAT or Exonerate may produce HSPs containing more than one HSPFragment. However, their native terminologies may differ: in BLAT these fragments are called 'blocks' while in Exonerate they are called exons or NER. Here are examples from each type of HSP. The first one comes from a BLAST search:: >>> from Bio import SearchIO >>> blast_qresult = next(SearchIO.parse('Blast/mirna.xml', 'blast-xml')) >>> blast_hsp = blast_qresult[1][0] # the first HSP from the second hit >>> blast_hsp HSP(hit_id='gi|301171311|ref|NR_035856.1|', query_id='33211', 1 fragments) >>> print(blast_hsp) Query: 33211 mir_1 Hit: gi|301171311|ref|NR_035856.1| Pan troglodytes microRNA mir-520b ... Query range: [1:61] (1) Hit range: [0:60] (1) Quick stats: evalue 1.7e-22; bitscore 109.49 Fragments: 1 (60 columns) Query - CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Hit - CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG For HSPs with a single HSPFragment, you can invoke ``print`` on it and see the underlying sequence alignment, if it exists. This is not the case for HSPs with more than one HSPFragment. Below is an example, using an HSP from a BLAT search. Invoking ``print`` on these HSPs will instead show a table of the HSPFragment objects it contains:: >>> blat_qresult = SearchIO.read('Blat/mirna.pslx', 'blat-psl', pslx=True) >>> blat_hsp = blat_qresult[1][0] # the first HSP from the second hit >>> blat_hsp HSP(hit_id='chr11', query_id='blat_1', 2 fragments) >>> print(blat_hsp) Query: blat_1 Hit: chr11 Query range: [42:67] (-1) Hit range: [59018929:59018955] (1) Quick stats: evalue ?; bitscore ? Fragments: --- -------------- ---------------------- ---------------------- # Span Query range Hit range --- -------------- ---------------------- ---------------------- 0 6 [61:67] [59018929:59018935] 1 16 [42:58] [59018939:59018955] Notice that in HSPs with more than one HSPFragments, the HSP's ``query_range`` ``hit_range`` properties encompasses all fragments it contains. You can check whether an HSP has more than one HSPFragments or not using the ``is_fragmented`` property:: >>> blast_hsp.is_fragmented False >>> blat_hsp.is_fragmented True Since HSP objects are also containers similar to Python lists, you can access a single fragment in an HSP using its integer index:: >>> blat_fragment = blat_hsp[0] >>> print(blat_fragment) Query: blat_1 Hit: chr11 Query range: [61:67] (-1) Hit range: [59018929:59018935] (1) Fragments: 1 (6 columns) Query - tatagt Hit - tatagt This applies to HSPs objects with a single fragment as well:: >>> blast_fragment = blast_hsp[0] >>> print(blast_fragment) Query: 33211 mir_1 Hit: gi|301171311|ref|NR_035856.1| Pan troglodytes microRNA mir-520b ... Query range: [1:61] (1) Hit range: [0:60] (1) Fragments: 1 (60 columns) Query - CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Hit - CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG Regardless of the search output file format, HSP objects provide the properties listed below. These properties always return values in a list, due to the HSP object itself being a list-like container. However, for HSP objects with a single HSPFragment, shortcut properties that fetches the item from the list are also provided. +----------------------+---------------------+-----------------------------+ | Property | Shortcut | Value | +======================+=====================+=============================+ | aln_all | aln | HSP alignments as | | | | MultipleSeqAlignment object | +----------------------+---------------------+-----------------------------+ | aln_annotation_all | aln_annotation | dictionary of annotation(s) | | | | of all fragments' alignments| +----------------------+---------------------+-----------------------------+ | fragments | fragment | HSPFragment objects | +----------------------+---------------------+-----------------------------+ | hit_all | hit | hit sequence as SeqRecord | | | | objects | +----------------------+---------------------+-----------------------------+ | hit_features_all | hit_features | SeqFeatures of all hit | | | | fragments | +----------------------+---------------------+-----------------------------+ | hit_start_all | hit_start* | start coordinates of the | | | | hit fragments | +----------------------+---------------------+-----------------------------+ | hit_end_all | hit_end* | end coordinates of the hit | | | | fragments | +----------------------+---------------------+-----------------------------+ | hit_span_all | hit_span* | sizes of each hit fragments | +----------------------+---------------------+-----------------------------+ | hit_strand_all | hit_strand | strand orientations of the | | | | hit fragments | +----------------------+---------------------+-----------------------------+ | hit_frame_all | hit_frame | reading frames of the hit | | | | fragments | +----------------------+---------------------+-----------------------------+ | hit_range_all | hit_range | tuples of start and end | | | | coordinates of each hit | | | | fragment | +----------------------+---------------------+-----------------------------+ | query_all | query | query sequence as SeqRecord | | | | object | +----------------------+---------------------+-----------------------------+ | query_features_all | query_features | SeqFeatures of all query | | | | fragments | +----------------------+---------------------+-----------------------------+ | query_start_all | query_start* | start coordinates of the | | | | fragments | +----------------------+---------------------+-----------------------------+ | query_end_all | query_end* | end coordinates of the | | | | query fragments | +----------------------+---------------------+-----------------------------+ | query_span_all | query_span* | sizes of each query | | | | fragments | +----------------------+---------------------+-----------------------------+ | query_strand_all | query_strand | strand orientations of the | | | | query fragments | +----------------------+---------------------+-----------------------------+ | query_frame_all | query_frame | reading frames of the query | | | | fragments | +----------------------+---------------------+-----------------------------+ | query_range_all | query_range | tuples of start and end | | | | coordinates of each query | | | | fragment | +----------------------+---------------------+-----------------------------+ For all types of HSP objects, the property will return the values in a list. Shorcuts are only applicable for HSPs with one fragment. Except the ones noted, if they are used on an HSP with more than one fragments, an exception will be raised. For properties that may be used in HSPs with multiple or single fragments (``*_start``, ``*_end``, and ``*_span`` properties), their interpretation depends on how many fragment the HSP has: +------------+---------------------------------------------------+ | Property | Value | +============+===================================================+ | hit_start | smallest coordinate value of all hit fragments | +------------+---------------------------------------------------+ | hit_end | largest coordinate value of all hit fragments | +------------+---------------------------------------------------+ | hit_span | difference between ``hit_start`` and ``hit_end`` | +------------+---------------------------------------------------+ | query_start| smallest coordinate value of all query fragments | +------------+---------------------------------------------------+ | query_end | largest coordinate value of all query fragments | +------------+---------------------------------------------------+ | query_span | difference between ``query_start`` and | | | ``query_end`` | +------------+---------------------------------------------------+ In addition to the objects listed above, HSP objects also provide the following properties: +--------------------+------------------------------------------------------+ | Property | Value | +====================+======================================================+ | aln_span | total number of residues in all HSPFragment objects | +--------------------+------------------------------------------------------+ | alphabet | alphabet used in hit and query SeqRecord objects | +--------------------+------------------------------------------------------+ | is_fragmented | boolean, whether there are multiple fragments or not | +--------------------+------------------------------------------------------+ | hit_id | ID of the hit sequence | +--------------------+------------------------------------------------------+ | hit_description | description of the hit sequence | +--------------------+------------------------------------------------------+ | hit_inter_ranges | list of hit sequence coordinates of the regions | | | between fragments | +--------------------+------------------------------------------------------+ | hit_inter_spans | list of lengths of the regions between hit fragments | +--------------------+------------------------------------------------------+ | query_id | ID of the query sequence | +--------------------+------------------------------------------------------+ | query_description | description of the query sequence | +--------------------+------------------------------------------------------+ | query_inter_ranges | list of query sequence coordinates of the regions | | | between fragments | +--------------------+------------------------------------------------------+ | query_inter_spans | list of lengths of the regions between query | | | fragments | +--------------------+------------------------------------------------------+ .. [1] may be used in HSPs with multiple fragments """ # attributes we don't want to transfer when creating a new Hit class # from this one _NON_STICKY_ATTRS = ('_items', ) def __init__(self, fragments=()): """Initializes an HSP object. :param fragments: fragments contained in the HSP object :type fragments: iterable yielding HSPFragment HSP objects must be initialized with a list containing at least one HSPFragment object. If multiple HSPFragment objects are used for initialization, they must all have the same ``query_id``, ``query_description``, ``hit_id``, ``hit_description``, and alphabet properties. """ if not fragments: raise ValueError("HSP objects must have at least one HSPFragment " "object.") # TODO - Move this into the for look in case hsps is a single use # iterable? # check that all fragments contain the same IDs, descriptions, alphabet for attr in ('query_id', 'query_description', 'hit_id', 'hit_description', 'alphabet'): if len(set(getattr(frag, attr) for frag in fragments)) != 1: raise ValueError("HSP object can not contain fragments with " "more than one %s." % attr) self._items = [] for fragment in fragments: self._validate_fragment(fragment) self._items.append(fragment) def __repr__(self): return "%s(hit_id=%r, query_id=%r, %r fragments)" % \ (self.__class__.__name__, self.hit_id, self.query_id, len(self)) def __iter__(self): return iter(self._items) def __contains__(self, fragment): return fragment in self._items def __len__(self): return len(self._items) # Python 3: def __bool__(self): return bool(self._items) # Python 2: __nonzero__ = __bool__ def __str__(self): lines = [] # set hsp info line statline = [] # evalue evalue = getattr_str(self, 'evalue', fmt='%.2g') statline.append('evalue ' + evalue) # bitscore bitscore = getattr_str(self, 'bitscore', fmt='%.2f') statline.append('bitscore ' + bitscore) lines.append('Quick stats: ' + '; '.join(statline)) if len(self.fragments) == 1: return '\n'.join([self._str_hsp_header(), '\n'.join(lines), self.fragments[0]._str_aln()]) else: lines.append(' Fragments: %s %s %s %s' % ('-' * 3, '-' * 14, '-' * 22, '-' * 22)) pattern = '%16s %14s %22s %22s' lines.append(pattern % ('#', 'Span', 'Query range', 'Hit range')) lines.append(pattern % ('-' * 3, '-' * 14, '-' * 22, '-' * 22)) for idx, block in enumerate(self.fragments): # set hsp line and table # alignment span aln_span = getattr_str(block, 'aln_span') # query region query_start = getattr_str(block, 'query_start') query_end = getattr_str(block, 'query_end') query_range = '[%s:%s]' % (query_start, query_end) # max column length is 20 query_range = trim_str(query_range, 22, '~]') # hit region hit_start = getattr_str(block, 'hit_start') hit_end = getattr_str(block, 'hit_end') hit_range = '[%s:%s]' % (hit_start, hit_end) hit_range = trim_str(hit_range, 22, '~]') # append the hsp row lines.append(pattern % (str(idx), aln_span, query_range, hit_range)) return self._str_hsp_header() + '\n' + '\n'.join(lines) def __getitem__(self, idx): # if key is slice, return a new HSP instance if isinstance(idx, slice): obj = self.__class__(self._items[idx]) self._transfer_attrs(obj) return obj return self._items[idx] def __setitem__(self, idx, fragments): # handle case if hsps is a list of hsp if isinstance(fragments, (list, tuple)): for fragment in fragments: self._validate_fragment(fragment) else: self._validate_fragment(fragments) self._items[idx] = fragments def __delitem__(self, idx): # note that this may result in an empty HSP object, which should be # invalid del self._items[idx] def _validate_fragment(self, fragment): if not isinstance(fragment, HSPFragment): raise TypeError("HSP objects can only contain HSPFragment " "objects.") # HACK: to make validation during __init__ work if self._items: if fragment.hit_id != self.hit_id: raise ValueError("Expected HSPFragment with hit ID %r, " "found %r instead." % (self.id, fragment.hit_id)) if fragment.hit_description != self.hit_description: raise ValueError("Expected HSPFragment with hit " "description %r, found %r instead." % (self.description, fragment.hit_description)) if fragment.query_id != self.query_id: raise ValueError("Expected HSPFragment with query ID %r, " "found %r instead." % (self.query_id, fragment.query_id)) if fragment.query_description != self.query_description: raise ValueError("Expected HSP with query description %r, " "found %r instead." % (self.query_description, fragment.query_description)) def _aln_span_get(self): # length of all alignments # alignment span can be its own attribute, or computed from # query / hit length return sum(frg.aln_span for frg in self.fragments) aln_span = property(fget=_aln_span_get, doc="""Total number of columns in all HSPFragment objects.""") # coordinate properties # def _get_coords(self, seq_type, coord_type): assert seq_type in ('hit', 'query') assert coord_type in ('start', 'end') coord_name = '%s_%s' % (seq_type, coord_type) coords = [getattr(frag, coord_name) for frag in self.fragments] if None in coords: warnings.warn("'None' exist in %s coordinates; ignored" % (coord_name), BiopythonWarning) return coords def _hit_start_get(self): return min(self._get_coords('hit', 'start')) hit_start = property(fget=_hit_start_get, doc="""Smallest coordinate value of all hit fragments""") def _query_start_get(self): return min(self._get_coords('query', 'start')) query_start = property(fget=_query_start_get, doc="""Smallest coordinate value of all query fragments""") def _hit_end_get(self): return max(self._get_coords('hit', 'end')) hit_end = property(fget=_hit_end_get, doc="""Largest coordinate value of all hit fragments""") def _query_end_get(self): return max(self._get_coords('query', 'end')) query_end = property(fget=_query_end_get, doc="""Largest coordinate value of all hit fragments""") # coordinate-dependent properties # def _hit_span_get(self): try: return self.hit_end - self.hit_start except TypeError: # triggered if any of the coordinates are None return None hit_span = property(fget=_hit_span_get, doc="""The number of hit residues covered by the HSP.""") def _query_span_get(self): try: return self.query_end - self.query_start except TypeError: # triggered if any of the coordinates are None return None query_span = property(fget=_query_span_get, doc="""The number of query residues covered by the HSP.""") def _hit_range_get(self): return (self.hit_start, self.hit_end) hit_range = property(fget=_hit_range_get, doc="""Tuple of HSP hit start and end coordinates.""") def _query_range_get(self): return (self.query_start, self.query_end) query_range = property(fget=_query_range_get, doc="""Tuple of HSP query start and end coordinates.""") def _inter_ranges_get(self, seq_type): # this property assumes that there are no mixed strands in a hit/query assert seq_type in ('query', 'hit') strand = getattr(self, '%s_strand_all' % seq_type)[0] coords = getattr(self, '%s_range_all' % seq_type) # determine function used to set inter range # start and end coordinates, given two pairs # of fragment start and end coordinates if strand == -1: startfunc, endfunc = min, max else: startfunc, endfunc = max, min inter_coords = [] for idx, coord in enumerate(coords[:-1]): start = startfunc(coords[idx]) end = endfunc(coords[idx + 1]) inter_coords.append((min(start, end), max(start, end))) return inter_coords def _hit_inter_ranges_get(self): return self._inter_ranges_get('hit') hit_inter_ranges = property(fget=_hit_inter_ranges_get, doc="""Hit sequence coordinates of the regions between fragments""") def _query_inter_ranges_get(self): return self._inter_ranges_get('query') query_inter_ranges = property(fget=_query_inter_ranges_get, doc="""Query sequence coordinates of the regions between fragments""") def _inter_spans_get(self, seq_type): assert seq_type in ('query', 'hit') attr_name = '%s_inter_ranges' % seq_type return [coord[1] - coord[0] for coord in getattr(self, attr_name)] def _hit_inter_spans_get(self): return self._inter_spans_get('hit') hit_inter_spans = property(fget=_hit_inter_spans_get, doc="""Lengths of regions between hit fragments""") def _query_inter_spans_get(self): return self._inter_spans_get('query') query_inter_spans = property(fget=_query_inter_spans_get, doc="""Lengths of regions between query fragments""") # shortcuts for fragments' properties # # bool check if there's more than one fragments is_fragmented = property(lambda self: len(self) > 1, doc="""Whether the HSP has more than one HSPFragment objects""") # first item properties with setters hit_description = fullcascade('hit_description', doc="""Description of the hit sequence""") query_description = fullcascade('query_description', doc="""Description of the query sequence""") hit_id = fullcascade('hit_id', doc="""ID of the hit sequence""") query_id = fullcascade('query_id', doc="""ID of the query sequence""") alphabet = fullcascade('alphabet', doc="""Alphabet used in hit and query SeqRecord objects""") # properties for single-fragment HSPs fragment = singleitem( doc="""HSPFragment object, first fragment""") hit = singleitem('hit', doc="""Hit sequence as a SeqRecord object, first fragment""") query = singleitem('query', doc="""Query sequence as a SeqRecord object, first fragment""") aln = singleitem('aln', doc="""Alignment of the first fragment as a MultipleSeqAlignment object""") aln_annotation = singleitem('aln_annotation', doc="""Dictionary of annotation(s) of the first fragment's alignment""") hit_features = singleitem('hit_features', doc="""Hit sequence features, first fragment""") query_features = singleitem('query_features', doc="""Query sequence features, first fragment""") hit_strand = singleitem('hit_strand', doc="""Hit strand orientation, first fragment""") query_strand = singleitem('query_strand', doc="""Query strand orientation, first fragment""") hit_frame = singleitem('hit_frame', doc="""Hit sequence reading frame, first fragment""") query_frame = singleitem('query_frame', doc="""Query sequence reading frame, first fragment""") # properties for multi-fragment HSPs fragments = allitems(doc="""List of all HSPFragment objects""") hit_all = allitems('hit', doc="""List of all fragments' hit sequences as SeqRecord objects""") query_all = allitems('query', doc="""List of all fragments' query sequences as SeqRecord objects""") aln_all = allitems('aln', doc="""List of all fragments' alignments as MultipleSeqAlignment objects""") aln_annotation_all = allitems('aln_annotation', doc="""Dictionary of annotation(s) of all fragments' alignments""") hit_features_all = allitems('hit_features', doc="""List of all hit sequence features""") query_features_all = allitems('query_features', doc="""List of all query sequence features""") hit_strand_all = allitems('hit_strand', doc="""List of all fragments' hit sequence strands""") query_strand_all = allitems('query_strand', doc="""List of all fragments' query sequence strands""") hit_frame_all = allitems('hit_frame', doc="""List of all fragments' hit sequence reading frames""") query_frame_all = allitems('query_frame', doc="""List of all fragments' query sequence reading frames""") hit_start_all = allitems('hit_start', doc="""List of all fragments' hit start coordinates""") query_start_all = allitems('query_start', doc="""List of all fragments' query start coordinates""") hit_end_all = allitems('hit_end', doc="""List of all fragments' hit end coordinates""") query_end_all = allitems('query_end', doc="""List of all fragments' query end coordinates""") hit_span_all = allitems('hit_span', doc="""List of all fragments' hit sequence size""") query_span_all = allitems('query_span', doc="""List of all fragments' query sequence size""") hit_range_all = allitems('hit_range', doc="""List of all fragments' hit start and end coordinates""") query_range_all = allitems('query_range', doc="""List of all fragments' query start and end coordinates""") class HSPFragment(_BaseHSP): """Class representing a contiguous alignment of hit-query sequence. HSPFragment forms the core of any parsed search output file. Depending on the search output file format, it may contain the actual query and/or hit sequences that produces the search hits. These sequences are stored as SeqRecord objects (see SeqRecord): >>> from Bio import SearchIO >>> qresult = next(SearchIO.parse('Blast/mirna.xml', 'blast-xml')) >>> fragment = qresult[0][0][0] # first hit, first hsp, first fragment >>> print(fragment) Query: 33211 mir_1 Hit: gi|262205317|ref|NR_030195.1| Homo sapiens microRNA 520b (MIR520... Query range: [0:61] (1) Hit range: [0:61] (1) Fragments: 1 (61 columns) Query - CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Hit - CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG # the query sequence is a SeqRecord object >>> fragment.query.__class__ >>> print(fragment.query) ID: 33211 Name: aligned query sequence Description: mir_1 Number of features: 0 Seq('CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTT...GGG', DNAAlphabet()) # the hit sequence is a SeqRecord object as well >>> fragment.hit.__class__ >>> print(fragment.hit) ID: gi|262205317|ref|NR_030195.1| Name: aligned hit sequence Description: Homo sapiens microRNA 520b (MIR520B), microRNA Number of features: 0 Seq('CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTT...GGG', DNAAlphabet()) # when both query and hit are present, we get a MultipleSeqAlignment object >>> fragment.aln.__class__ >>> print(fragment.aln) DNAAlphabet() alignment with 2 rows and 61 columns CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAG...GGG 33211 CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAG...GGG gi|262205317|ref|NR_030195.1| """ def __init__(self, hit_id='', query_id='', hit=None, query=None, alphabet=single_letter_alphabet): self._alphabet = alphabet self.aln_annotation = {} self._hit_id = hit_id self._query_id = query_id for seq_type in ('query', 'hit'): # query or hit attributes default attributes setattr(self, '_%s_description' % seq_type, '') setattr(self, '_%s_features' % seq_type, []) # query or hit attributes whose default attribute is None for attr in ('strand', 'frame', 'start', 'end'): setattr(self, '%s_%s' % (seq_type, attr), None) # self.query or self.hit if eval(seq_type): setattr(self, seq_type, eval(seq_type)) else: setattr(self, seq_type, None) def __repr__(self): info = "hit_id=%r, query_id=%r" % (self.hit_id, self.query_id) try: info += ", %i columns" % len(self) except AttributeError: pass return "%s(%s)" % (self.__class__.__name__, info) def __len__(self): return self.aln_span def __str__(self): return self._str_hsp_header() + '\n' + self._str_aln() def __getitem__(self, idx): if self.aln is not None: obj = self.__class__( hit_id=self.hit_id, query_id=self.query_id, alphabet=self.alphabet) # transfer query and hit attributes # let SeqRecord handle feature slicing, then retrieve the sliced # features into the sliced HSPFragment if self.query is not None: obj.query = self.query[idx] obj.query_features = obj.query.features if self.hit is not None: obj.hit = self.hit[idx] obj.hit_features = obj.hit.features # description, strand, frame for attr in ('description', 'strand', 'frame'): for seq_type in ('hit', 'query'): attr_name = '%s_%s' % (seq_type, attr) self_val = getattr(self, attr_name) setattr(obj, attr_name, self_val) # alignment annotation should be transferred, since we can compute # the resulting annotation obj.aln_annotation = {} for key, value in self.aln_annotation.items(): assert len(value[idx]) == len(obj) obj.aln_annotation[key] = value[idx] return obj else: raise TypeError("Slicing for HSP objects without " "alignment is not supported.") def _str_aln(self): lines = [] # alignment length aln_span = getattr_str(self, 'aln_span') lines.append(' Fragments: 1 (%s columns)' % aln_span) # sequences if self.query is not None and self.hit is not None: try: qseq = str(self.query.seq) except AttributeError: # query is None qseq = '?' try: hseq = str(self.hit.seq) except AttributeError: # hit is None hseq = '?' # similarity line simil = '' if 'similarity' in self.aln_annotation and \ isinstance(self.aln_annotation.get('similarity'), basestring): simil = self.aln_annotation['similarity'] if self.aln_span <= 67: lines.append("%10s - %s" % ('Query', qseq)) if simil: lines.append(" %s" % simil) lines.append("%10s - %s" % ('Hit', hseq)) else: # adjust continuation character length, so we don't display # the same residues twice if self.aln_span - 66 > 3: cont = '~' * 3 else: cont = '~' * (self.aln_span - 66) lines.append("%10s - %s%s%s" % ('Query', qseq[:59], cont, qseq[-5:])) if simil: lines.append(" %s%s%s" % (simil[:59], cont, simil[-5:])) lines.append("%10s - %s%s%s" % ('Hit', hseq[:59], cont, hseq[-5:])) return '\n'.join(lines) # sequence properties # def _set_seq(self, seq, seq_type): """Checks the given sequence for attribute setting :param seq: sequence to check :type seq: string or SeqRecord :param seq_type: sequence type :type seq_type: string, choice of 'hit' or 'query' """ assert seq_type in ('hit', 'query') if seq is None: return seq # return immediately if seq is None else: if not isinstance(seq, (basestring, SeqRecord)): raise TypeError("%s sequence must be a string or a SeqRecord" " object." % seq_type) # check length if the opposite sequence is not None opp_type = 'hit' if seq_type == 'query' else 'query' opp_seq = getattr(self, '_%s' % opp_type, None) if opp_seq is not None: if len(seq) != len(opp_seq): raise ValueError("Sequence lengths do not match. Expected: " "%r (%s); found: %r (%s)." % (len(opp_seq), opp_type, len(seq), seq_type)) seq_id = getattr(self, '%s_id' % seq_type) seq_desc = getattr(self, '%s_description' % seq_type) seq_feats = getattr(self, '%s_features' % seq_type) seq_name = 'aligned %s sequence' % seq_type if isinstance(seq, SeqRecord): seq.id = seq_id seq.description = seq_desc seq.name = seq_name seq.features = seq_feats seq.seq.alphabet = self.alphabet elif isinstance(seq, basestring): seq = SeqRecord(Seq(seq, self.alphabet), id=seq_id, name=seq_name, description=seq_desc, features=seq_feats) return seq def _hit_get(self): return self._hit def _hit_set(self, value): self._hit = self._set_seq(value, 'hit') hit = property(fget=_hit_get, fset=_hit_set, doc="""Hit sequence as a SeqRecord object, defaults to None""") def _query_get(self): return self._query def _query_set(self, value): self._query = self._set_seq(value, 'query') query = property(fget=_query_get, fset=_query_set, doc="""Query sequence as a SeqRecord object, defaults to None""") def _aln_get(self): if self.query is None and self.hit is None: return None elif self.hit is None: return MultipleSeqAlignment([self.query], self.alphabet) elif self.query is None: return MultipleSeqAlignment([self.hit], self.alphabet) else: return MultipleSeqAlignment([self.query, self.hit], self.alphabet) aln = property(fget=_aln_get, doc="""Query-hit alignment as a MultipleSeqAlignment object, defaults to None""") def _alphabet_get(self): return self._alphabet def _alphabet_set(self, value): self._alphabet = value try: self.query.seq.alphabet = value except AttributeError: pass try: self.hit.seq.alphabet = value except AttributeError: pass alphabet = property(fget=_alphabet_get, fset=_alphabet_set, doc="""Alphabet object used in the fragment's sequences and alignment, defaults to single_letter_alphabet""") def _aln_span_get(self): # length of alignment (gaps included) # alignment span can be its own attribute, or computed from # query / hit length if not hasattr(self, '_aln_span'): if self.query is not None: self._aln_span = len(self.query) elif self.hit is not None: self._aln_span = len(self.hit) return self._aln_span def _aln_span_set(self, value): self._aln_span = value aln_span = property(fget=_aln_span_get, fset=_aln_span_set, doc="""The number of alignment columns covered by the fragment""") # id, description, and features properties # hit_description = fragcascade('description', 'hit', doc="""Hit sequence description""") query_description = fragcascade('description', 'query', doc="""Query sequence description""") hit_id = fragcascade('id', 'hit', doc="""Hit sequence ID""") query_id = fragcascade('id', 'query', doc="""Query sequence ID""") hit_features = fragcascade('features', 'hit', doc="""Hit sequence features""") query_features = fragcascade('features', 'query', doc="""Query sequence features""") # strand properties # def _prep_strand(self, strand): # follow SeqFeature's convention if strand not in (-1, 0, 1, None): raise ValueError("Strand should be -1, 0, 1, or None; not %r" % strand) return strand def _get_strand(self, seq_type): assert seq_type in ('hit', 'query') strand = getattr(self, '_%s_strand' % seq_type) if strand is None: # try to compute strand from frame frame = getattr(self, '%s_frame' % seq_type) if frame is not None: try: strand = frame // abs(frame) except ZeroDivisionError: strand = 0 setattr(self, '%s_strand' % seq_type, strand) return strand def _hit_strand_get(self): return self._get_strand('hit') def _hit_strand_set(self, value): self._hit_strand = self._prep_strand(value) hit_strand = property(fget=_hit_strand_get, fset=_hit_strand_set, doc="""Hit sequence strand, defaults to None""") def _query_strand_get(self): return self._get_strand('query') def _query_strand_set(self, value): self._query_strand = self._prep_strand(value) query_strand = property(fget=_query_strand_get, fset=_query_strand_set, doc="""Query sequence strand, defaults to None""") # frame properties # def _prep_frame(self, frame): if frame not in (-3, -2, -1, 0, 1, 2, 3, None): raise ValueError("Strand should be an integer between -3 and 3, " "or None; not %r" % frame) return frame def _hit_frame_get(self): return self._hit_frame def _hit_frame_set(self, value): self._hit_frame = self._prep_frame(value) hit_frame = property(fget=_hit_frame_get, fset=_hit_frame_set, doc="""Hit sequence reading frame, defaults to None""") def _query_frame_get(self): return self._query_frame def _query_frame_set(self, value): self._query_frame = self._prep_frame(value) query_frame = property(fget=_query_frame_get, fset=_query_frame_set, doc="""Query sequence reading frame, defaults to None""") # coordinate properties # def _prep_coord(self, coord, opp_coord_name, op): # coord must either be None or int if coord is None: return coord assert isinstance(coord, int) # try to get opposite coordinate, if it's not present, return try: opp_coord = getattr(self, opp_coord_name) except AttributeError: return coord # if opposite coordinate is None, return if opp_coord is None: return coord # otherwise compare it to coord ('>=' or '<=') else: assert op(coord, opp_coord) return coord def _hit_start_get(self): return self._hit_start def _hit_start_set(self, value): self._hit_start = self._prep_coord(value, 'hit_end', le) hit_start = property(fget=_hit_start_get, fset=_hit_start_set, doc="""Hit sequence start coordinate, defaults to None""") def _query_start_get(self): return self._query_start def _query_start_set(self, value): self._query_start = self._prep_coord(value, 'query_end', le) query_start = property(fget=_query_start_get, fset=_query_start_set, doc="""Query sequence start coordinate, defaults to None""") def _hit_end_get(self): return self._hit_end def _hit_end_set(self, value): self._hit_end = self._prep_coord(value, 'hit_start', ge) hit_end = property(fget=_hit_end_get, fset=_hit_end_set, doc="""Hit sequence start coordinate, defaults to None""") def _query_end_get(self): return self._query_end def _query_end_set(self, value): self._query_end = self._prep_coord(value, 'query_start', ge) query_end = property(fget=_query_end_get, fset=_query_end_set, doc="""Query sequence end coordinate, defaults to None""") # coordinate-dependent properties # def _hit_span_get(self): try: return self.hit_end - self.hit_start except TypeError: # triggered if any of the coordinates are None return None hit_span = property(fget=_hit_span_get, doc="""The number of residues covered by the hit sequence""") def _query_span_get(self): try: return self.query_end - self.query_start except TypeError: # triggered if any of the coordinates are None return None query_span = property(fget=_query_span_get, doc="""The number of residues covered by the query sequence""") def _hit_range_get(self): return (self.hit_start, self.hit_end) hit_range = property(fget=_hit_range_get, doc="""Tuple of hit start and end coordinates""") def _query_range_get(self): return (self.query_start, self.query_end) query_range = property(fget=_query_range_get, doc="""Tuple of query start and end coordinates""") # if not used as a module, run the doctest if __name__ == "__main__": from Bio._utils import run_doctest run_doctest()