funnel.doc update 10/27/90 FUNNEL I. Function- Reads in a DNA or RNA sequence and writes it to a file, with a fixed number or characters (LINELENGTH) per line, as set by user. NOTE: FUNNEL WILL NOT WORK CORRECTLY ON BIONET OR GENBANK FILES. NEW FEATURES The right arrow (>) is also interpreted by FUNNEL as a comment. This is convenient for FUNNELing Pearson format files. The maximum line length is set to 10000, to permit the generation of long output lines, that are sometimes convenient to have. DESCRIPTION The most efficient way to type in a sequence is by spacing every five or ten bases. This makes proofreading easy. However, blank spaces make a file bigger than it needs to be, and therefore slower for a program to read. FUNNEL's job is to take a sequence, after it has been stored as a TEXT file and proofread, and compress it into a file containing a user-specified number of bases on each line (LINESIZE). FUNNEL faithfully copies upper and lower case letters (amino acid sequences as well as nucleic acids), from one file to another. Comments are also transferred, although each comment in the reformatted file will be written to a separate line. FUNNEL is most useful when used in conjunction with NUMSEQ. If a sequence has previously been numbered with NUMSEQ, one can write changes (such as insertions or deletions based on new sequencing experiments) on the NUMSEQ printout, and then go back to the original file, formatted by FUNNEL, and easily find the corresponding region, using the numbered printout as a guide. Parameters: LINESIZE no. of nucleotides written per line to output file. Example: Given the following input file, ; EXP #190 gggca cccaa ttata ccctt cccta ggtagttta ntttc tttcc cagagc ccaga ccatt tttca cccc tatgg cagat ccatg gacca tcaat tatat ttaca cctt aaaaa aacaa atata ; EXP #191 & #192 gatac cataa aacct TTAAT AAAAA AAAAC CAATA CATTA CAAAT TATAT aACCAG GAAGA GAATT and specifying LINESIZE to be 40,FUNNEL will produce the output file ; EXP #190 gggcacccaattatacccttccctaggtagtttantttct ttcccagagcccagaccatttttcacccctatggcagatc catggaccatcaattatatttacaccttaaaaaaacaaat ata ; EXP #191 & #192 gataccataaaacctTTAATAAAAAAAAACCAATACATTA CAAATTATATaACCAGGAAGAGAATT