BLASTN 2.0.10 [Aug-26-1999]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= gi|859351|gb|G06106.1|G06106 human STS WI-6344. (183 letters) Database: Non-redundant Database of GenBank STS Division 89,405 sequences; 32,867,852 total letters

If you have any problems or questions with the results of this search
please refer to the BLAST FAQs

Distribution of 6 Blast Hits on the Query Sequence



                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gb|G06106|G06106  human STS WI-6344.                              327  1e-89
gb|G21024|G21024  human STS WI-30979.                              32  1.1
gb|G60966.1|G60966  SHGC-84377 Human Homo sapiens STS genomi...    30  4.2
gb|G51244.1|G51244  SHGC-80725 Human Homo sapiens STS genomi...    30  4.2
gb|G20319|G20319  human STS A005L39.                               30  4.2
gb|G07281|G07281  human STS WI-9430.                               30  4.2

blast_tmp 1   acttgggnctacatgggccagaggtggtttattcagtctccataagagaggggacaaacg 60
G06106    1   ............................................................ 60
G60966    49                                       ...............         63
G20319    53                    ...............                            39
G07281    172                   ...............                            158

blast_tmp 61  gcacagttgggtccgtgaagaggagggtccaagagctnacaagagagcctctctgagatt 120
G06106    61  ............................................................ 120
G21024    33           .............a......                                14

blast_tmp 121 tgacccctncatcccctnctcagggnggttgtggagtcactgggcctcatgggntaggcc 180
G06106    121 ............................................................ 180
G51244    184                                     ...............          198

blast_tmp 181 cag 183
G06106    181 ... 183
  Database: Non-redundant Database of GenBank STS Division
    Posted date:  Dec 18, 1999  7:45 PM
  Number of letters in database: 32,867,852
  Number of sequences in database:  89,405
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1988
Number of Sequences: 89405
Number of extensions: 1988
Number of successful extensions: 517
Number of sequences better than 10.0: 8
length of query: 183
length of database: 32,867,852
effective HSP length: 16
effective length of query: 167
effective length of database: 31,437,372
effective search space: 5250041124
effective search space used: 5250041124
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 10 (19.8 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)