# Copyright 2004-2008 by Sebastian Bassi.
# All rights reserved.
# This code is part of the Biopython distribution and governed by its
# license.  Please see the LICENSE file that should have been included
# as part of this package.

"""Calculate the thermodynamic melting temperatures of nucleotide sequences."""

import math
def Tm_staluc(s,dnac=50,saltc=50,rna=0):
    """Returns DNA/DNA tm using nearest neighbor thermodynamics.

    dnac is DNA concentration [nM]
    saltc is salt concentration [mM].
    rna=0 is for DNA/DNA (default), for RNA, rna should be 1.
    
    Sebastian Bassi <sbassi@genesdigitales.com>"""
    
    #Credits: 
    #Main author: Sebastian Bassi <sbassi@genesdigitales.com>
    #Overcount function: Greg Singer <singerg@tcd.ie>
    #Based on the work of Nicolas Le Novere <lenov@ebi.ac.uk> Bioinformatics.
    #17:1226-1227(2001)

    #This function returns better results than EMBOSS DAN because it uses
    #updated thermodynamics values and takes into account inicialization
    #parameters from the work of SantaLucia (1998).
    
    #Things to do:
    #+Detect complementary sequences. Change K according to result.
    #+Add support for heteroduplex (see Sugimoto et al. 1995).
    #+Correction for Mg2+. Now supports only monovalent ions.
    #+Put thermodinamics table in a external file for users to change at will
    #+Add support for danglings ends (see Le Novele. 2001) and mismatches.
    
    dh = 0 #DeltaH. Enthalpy
    ds = 0 #deltaS Entropy

    def tercorr(stri):
        deltah = 0
        deltas = 0
        if rna==0:
            #DNA/DNA
            #Allawi and SantaLucia (1997). Biochemistry 36 : 10581-10594
            if stri.startswith('G') or stri.startswith('C'):
                deltah -= 0.1
                deltas += 2.8
            elif stri.startswith('A') or stri.startswith('T'):
                deltah -= 2.3
                deltas -= 4.1
            if stri.endswith('G') or stri.endswith('C'):
                deltah -= 0.1
                deltas += 2.8
            elif stri.endswith('A') or stri.endswith('T'):
                deltah -= 2.3
                deltas -= 4.1
            dhL = dh + deltah
            dsL = ds + deltas
            return dsL,dhL
        elif rna==1:
            #RNA
            if stri.startswith('G') or stri.startswith('C'):
                deltah -= 3.61
                deltas -= 1.5
            elif stri.startswith('A') or stri.startswith('T') or \
                 stri.startswith('U'):
                deltah -= 3.72
                deltas += 10.5
            if stri.endswith('G') or stri.endswith('C'):
                deltah -= 3.61
                deltas -= 1.5
            elif stri.endswith('A') or stri.endswith('T') or \
                 stri.endswith('U'):
                deltah -= 3.72
                deltas += 10.5
            dhL = dh + deltah
            dsL = ds + deltas
            # print "delta h=",dhL
            return dsL,dhL

    def overcount(st,p):
        """Returns how many p are on st, works even for overlapping"""
        ocu = 0
        x = 0
        while 1:
            try:
                i = st.index(p,x)
            except ValueError:
                break
            ocu += 1
            x = i + 1
        return ocu

    R = 1.987 # universal gas constant in Cal/degrees C*Mol
    sup = s.upper()
    vsTC,vh = tercorr(sup)
    vs = vsTC
    
    k = (dnac/4.0)*1e-9
    #With complementary check on, the 4.0 should be changed to a variable.
    
    if rna==0:
        #DNA/DNA
        #Allawi and SantaLucia (1997). Biochemistry 36 : 10581-10594
        vh = vh + (overcount(sup,"AA"))*7.9 + (overcount(sup,"TT"))*\
        7.9 + (overcount(sup,"AT"))*7.2 + (overcount(sup,"TA"))*7.2 \
        + (overcount(sup,"CA"))*8.5 + (overcount(sup,"TG"))*8.5 + \
        (overcount(sup,"GT"))*8.4 + (overcount(sup,"AC"))*8.4
        vh = vh + (overcount(sup,"CT"))*7.8+(overcount(sup,"AG"))*\
        7.8 + (overcount(sup,"GA"))*8.2 + (overcount(sup,"TC"))*8.2
        vh = vh + (overcount(sup,"CG"))*10.6+(overcount(sup,"GC"))*\
        9.8 + (overcount(sup,"GG"))*8 + (overcount(sup,"CC"))*8
        vs = vs + (overcount(sup,"AA"))*22.2+(overcount(sup,"TT"))*\
        22.2 + (overcount(sup,"AT"))*20.4 + (overcount(sup,"TA"))*21.3
        vs = vs + (overcount(sup,"CA"))*22.7+(overcount(sup,"TG"))*\
        22.7 + (overcount(sup,"GT"))*22.4 + (overcount(sup,"AC"))*22.4
        vs = vs + (overcount(sup,"CT"))*21.0+(overcount(sup,"AG"))*\
        21.0 + (overcount(sup,"GA"))*22.2 + (overcount(sup,"TC"))*22.2
        vs = vs + (overcount(sup,"CG"))*27.2+(overcount(sup,"GC"))*\
        24.4 + (overcount(sup,"GG"))*19.9 + (overcount(sup,"CC"))*19.9
        ds = vs
        dh = vh
        
    else:
        #RNA/RNA hybridisation of Xia et al (1998)
        #Biochemistry 37: 14719-14735         
        vh = vh+(overcount(sup,"AA"))*6.82+(overcount(sup,"TT"))*6.6+\
        (overcount(sup,"AT"))*9.38 + (overcount(sup,"TA"))*7.69+\
        (overcount(sup,"CA"))*10.44 + (overcount(sup,"TG"))*10.5+\
        (overcount(sup,"GT"))*11.4 + (overcount(sup,"AC"))*10.2
        vh = vh + (overcount(sup,"CT"))*10.48 + (overcount(sup,"AG"))\
        *7.6+(overcount(sup,"GA"))*12.44+(overcount(sup,"TC"))*13.3
        vh = vh + (overcount(sup,"CG"))*10.64 + (overcount(sup,"GC"))\
        *14.88+(overcount(sup,"GG"))*13.39+(overcount(sup,"CC"))*12.2
        vs = vs + (overcount(sup,"AA"))*19.0 + (overcount(sup,"TT"))*\
        18.4+(overcount(sup,"AT"))*26.7+(overcount(sup,"TA"))*20.5
        vs = vs + (overcount(sup,"CA"))*26.9 + (overcount(sup,"TG"))*\
        27.8 + (overcount(sup,"GT"))*29.5 + (overcount(sup,"AC"))*26.2
        vs = vs + (overcount(sup,"CT"))*27.1 + (overcount(sup,"AG"))*\
        19.2 + (overcount(sup,"GA"))*32.5 + (overcount(sup,"TC"))*35.5
        vs = vs + (overcount(sup,"CG"))*26.7 + (overcount(sup,"GC"))\
        *36.9 + (overcount(sup,"GG"))*32.7 + (overcount(sup,"CC"))*29.7
        ds = vs
        dh = vh

    ds = ds-0.368*(len(s)-1)*math.log(saltc/1e3)
    tm = ((1000* (-dh))/(-ds+(R * (math.log(k)))))-273.15
    # print "ds="+str(ds)
    # print "dh="+str(dh)
    return tm

if __name__ == "__main__":
    print("Quick self test")
    assert Tm_staluc('CAGTCAGTACGTACGTGTACTGCCGTA') == 59.865612727457972
    assert Tm_staluc('CAGTCAGTACGTACGTGTACTGCCGTA',rna=1) == 68.141611264576682
    print("Done")