BLASTN 2.0.10 [Aug-26-1999]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= gi|1348916|gb|G26684|G26684 human STS
STS_D11570.
gi|1375195|gb|G26945|G26945 human STS SHGC-32699.
         (285 letters)

Database: data/sts
           87,792 sequences; 31,998,854 total letters

Searching..................................................done

                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gi|1348916|gb|G26684|G26684 human STS STS_D11570. >gi|1375195|g...   517  e-146
gi|720683|gb|G03725|G03725 human STS WI-344.                          32  1.6
gi|4516686|dbj|AU026763.1|AU026763 Rattus norvegicus, OTSUKA cl...    32  1.6
gi|6120827|gb|G55508.1|G55508 SHGC-100856 Human Homo sapiens ST...    32  1.6

>gi|1348916|gb|G26684|G26684 human STS STS_D11570.
           >gi|1375195|gb|G26945|G26945 human STS SHGC-32699.
           Length = 285
           
 Score =  517 bits (261), Expect = e-146
 Identities = 285/285 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   gatccctacccttnccgttggtctctntcgctgactcgaggcacctaacatccattcaca 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gatccctacccttnccgttggtctctntcgctgactcgaggcacctaacatccattcaca 60

                                                                       
Query: 61  cccaacacaggccagcgacttctggggctcagccacagacatggtttgtnactnttgagc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  cccaacacaggccagcgacttctggggctcagccacagacatggtttgtnactnttgagc 120

                                                                       
Query: 121 ttctgttcctagagaatcctagaggcttgattggcccaggctgctgtntgtnctggaggc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 ttctgttcctagagaatcctagaggcttgattggcccaggctgctgtntgtnctggaggc 180

                                                                       
Query: 181 aaagaatccctacctcctaggggtgaaaggaaatnaaaatggaaagttcttgtagcgcaa 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 aaagaatccctacctcctaggggtgaaaggaaatnaaaatggaaagttcttgtagcgcaa 240

                                                        
Query: 241 ggcctgacatgggtagctgctcaataaatgctagtntgttatttc 285
           |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 ggcctgacatgggtagctgctcaataaatgctagtntgttatttc 285


>gi|720683|gb|G03725|G03725 human STS WI-344.
           Length = 246
           
 Score = 32.2 bits (16), Expect = 1.6
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                           
Query: 260 ctcaataaatgctagt 275
           ||||||||||||||||
Sbjct: 178 ctcaataaatgctagt 163


>gi|4516686|dbj|AU026763.1|AU026763 Rattus norvegicus, OTSUKA clone,
           OT33.16/752f07, microsatellite sequence, sequence tagged
           site
           Length = 307
           
 Score = 32.2 bits (16), Expect = 1.6
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                           
Query: 221 ggaaagttcttgtagc 236
           ||||||||||||||||
Sbjct: 32  ggaaagttcttgtagc 47


>gi|6120827|gb|G55508.1|G55508 SHGC-100856 Human Homo sapiens STS
           genomic, sequence tagged site
           Length = 711
           
 Score = 32.2 bits (16), Expect = 1.6
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                              
Query: 210 gaaatnaaaatggaaagtt 228
           ||||| |||||||||||||
Sbjct: 588 gaaataaaaatggaaagtt 606


  Database: data/sts
    Posted date:  Nov 26, 1999  5:52 PM
  Number of letters in database: 31,998,854
  Number of sequences in database:  87,792
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3835
Number of Sequences: 87792
Number of extensions: 3835
Number of successful extensions: 1155
Number of sequences better than 10.0: 4
length of query: 285
length of database: 31,998,854
effective HSP length: 17
effective length of query: 268
effective length of database: 30,506,390
effective search space: 8175712520
effective search space used: 8175712520
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 25 (49.6 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)