BLASTN 2.0.10 [Aug-26-1999]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= gi|1347201|gb|G24969.1|G24969 human STS EST21946.
         (331 letters)

Database: Non-redundant Database of GenBank STS Division
           89,405 sequences; 32,867,852 total letters

 
If you have any problems or questions with the results of this search 
please refer to the BLAST FAQs

 gb|G24969|G24969 human STS EST21946. >gi|1375315|gb|G27065|G27065 human STS
           SHGC-31731.
           Length = 331
           
 Score =  656 bits (331), Expect = 0.0
 Identities = 331/331 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   cctccaccctctcatgagcaacaggatatgtgaaagtacttgcagccagaagcaaaacca 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   cctccaccctctcatgagcaacaggatatgtgaaagtacttgcagccagaagcaaaacca 60

                                                                       
Query: 61  caatcctcgggtgctagatggagctccccaaggagcagagaggaaaaggcaggaggagag 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  caatcctcgggtgctagatggagctccccaaggagcagagaggaaaaggcaggaggagag 120

                                                                       
Query: 121 ggccaggcagcagggatggagactaagtttggcccaaggctgcccgcaagcactgatgcc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 ggccaggcagcagggatggagactaagtttggcccaaggctgcccgcaagcactgatgcc 180

                                                                       
Query: 181 atcatgccctctggtaggtgtctatttctgtctgaaccagaaatacaccaagctccacac 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 atcatgccctctggtaggtgtctatttctgtctgaaccagaaatacaccaagctccacac 240

                                                                       
Query: 241 atgggggctttgctggcttcgacatcactggttcaactatgtcactgctttgttatattt 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 atgggggctttgctggcttcgacatcactggttcaactatgtcactgctttgttatattt 300

                                          
Query: 301 agtgctccagaacctcaggttccttcagatt 331
           |||||||||||||||||||||||||||||||
Sbjct: 301 agtgctccagaacctcaggttccttcagatt 331



 emb|AL010115|HSPE77H4 H.sapiens flow-sorted chromosome 1 HindIII fragment, SC1pE77H4,
           sequence tagged site [Homo sapiens]
           Length = 554
           
 Score = 34.2 bits (17), Expect = 0.50
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 123 ccaggcagcagggatgg 139
           |||||||||||||||||
Sbjct: 434 ccaggcagcagggatgg 418



 gb|G49267.1|G49267 stbK343C1_96809 chromosome 22 genomic clone Homo sapiens STS
           genomic clone 343C1, sequence tagged site
           Length = 360
           
 Score = 32.2 bits (16), Expect = 2.0
 Identities = 22/24 (91%)
 Strand = Plus / Minus

                                   
Query: 112 ggaggagagggccaggcagcaggg 135
           ||||||||||| | ||||||||||
Sbjct: 287 ggaggagaggggctggcagcaggg 264



 gb|G47248.1|G47248 Z17392_1 Zebrafish AB Danio rerio STS genomic clone Z17392 5',
           sequence tagged site
           Length = 454
           
 Score = 32.2 bits (16), Expect = 2.0
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                           
Query: 48  agaagcaaaaccacaa 63
           ||||||||||||||||
Sbjct: 434 agaagcaaaaccacaa 449



 gb|G55412.1|G55412 SHGC-100745 Human Homo sapiens STS genomic, sequence tagged site
           Length = 652
           
 Score = 32.2 bits (16), Expect = 2.0
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                           
Query: 99  agaggaaaaggcagga 114
           ||||||||||||||||
Sbjct: 431 agaggaaaaggcagga 416



 emb|Z53965|HSC009WH1 H.sapiens (D2S2321) DNA segment containing (CA) repeat; clone
           AFMc009wh1; single read, sequence tagged site [Homo
           sapiens]
           Length = 382
           
 Score = 32.2 bits (16), Expect = 2.0
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                           
Query: 97  agagaggaaaaggcag 112
           ||||||||||||||||
Sbjct: 107 agagaggaaaaggcag 122



 gb|G08807|G08807 human STS CHLC.GATA70E11.P18111 clone GATA70E11
           Length = 643
           
 Score = 32.2 bits (16), Expect = 2.0
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                           
Query: 100 gaggaaaaggcaggag 115
           ||||||||||||||||
Sbjct: 482 gaggaaaaggcaggag 467



 gb|G21813|G21813 human STS WI-12408.
           Length = 418
           
 Score = 32.2 bits (16), Expect = 2.0
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                           
Query: 47  cagaagcaaaaccaca 62
           ||||||||||||||||
Sbjct: 193 cagaagcaaaaccaca 178



 gb|G02824|G02824 human STS WI-1312.
           Length = 349
           
 Score = 32.2 bits (16), Expect = 2.0
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                           
Query: 286 tgctttgttatattta 301
           ||||||||||||||||
Sbjct: 111 tgctttgttatattta 126




  Database: Non-redundant Database of GenBank STS Division
    Posted date:  Dec 18, 1999  7:45 PM
  Number of letters in database: 32,867,852
  Number of sequences in database:  89,405
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7042
Number of Sequences: 89405
Number of extensions: 7042
Number of successful extensions: 1951
Number of sequences better than 10.0: 13
length of query: 331
length of database: 32,867,852
effective HSP length: 17
effective length of query: 314
effective length of database: 31,347,967
effective search space: 9843261638
effective search space used: 9843261638
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 10 (19.8 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)