******************************************************************************** MAST - Motif Alignment and Search Tool ******************************************************************************** MAST version 3.0 (Release date: 2004/08/18 09:07:01) For further information on how to interpret these results or to get a copy of the MAST software please access http://meme.sdsc.edu. ******************************************************************************** ******************************************************************************** REFERENCE ******************************************************************************** If you use this program in your research, please cite: Timothy L. Bailey and Michael Gribskov, "Combining evidence using p-values: application to sequence homology searches", Bioinformatics, 14(48-54), 1998. ******************************************************************************** ******************************************************************************** DATABASE AND MOTIFS ******************************************************************************** DATABASE INO_up800.s (nucleotide) Last updated on Mon Aug 16 21:19:59 2004 Database contains 7 sequences, 5600 residues Scores for positive and reverse complement strands are combined. MOTIFS meme.INO_up800.oops.txt (nucleotide) MOTIF WIDTH BEST POSSIBLE MATCH ----- ----- ------------------- 1 12 TTCACATGCCGC 2 10 TCTGGCACAG PAIRWISE MOTIF CORRELATIONS: MOTIF 1 ----- ----- 2 0.32 No overly similar pairs (correlation > 0.60) found. Random model letter frequencies (from non-redundant database): A 0.281 C 0.222 G 0.229 T 0.267 ******************************************************************************** ******************************************************************************** SECTION I: HIGH-SCORING SEQUENCES ******************************************************************************** - Each of the following 7 sequences has E-value less than 10. - The E-value of a sequence is the expected number of sequences in a random database of the same size that would match the motifs as well as the sequence does and is equal to the combined p-value of the sequence times the number of sequences in the database. - The combined p-value of a sequence measures the strength of the match of the sequence to all the motifs and is calculated by o finding the score of the single best match of each motif to the sequence (best matches may overlap), o calculating the sequence p-value of each score, o forming the product of the p-values, o taking the p-value of the product. - The sequence p-value of a score is defined as the probability of a random sequence of the same length containing some match with as good or better a score. - The score for the match of a position in a sequence to a motif is computed by by summing the appropriate entry from each column of the position-dependent scoring matrix that represents the motif. - Sequences shorter than one or more of the motifs are skipped. - The table is sorted by increasing E-value. ******************************************************************************** SEQUENCE NAME DESCRIPTION E-VALUE LENGTH ------------- ----------- -------- ------ ACC1 sequence of the region up... 6.1e-05 800 CHO1 sequence of the region up... 0.00016 800 INO1 sequence of the region up... 0.00019 800 FAS1 sequence of the region up... 0.00022 800 OPI3 sequence of the region up... 0.00092 800 CHO2 sequence of the region up... 0.0029 800 FAS2 sequence of the region up... 0.0093 800 ******************************************************************************** ******************************************************************************** SECTION II: MOTIF DIAGRAMS ******************************************************************************** - The ordering and spacing of all non-overlapping motif occurrences are shown for each high-scoring sequence listed in Section I. - A motif occurrence is defined as a position in the sequence whose match to the motif has POSITION p-value less than 0.0001. - The POSITION p-value of a match is the probability of a single random subsequence of the length of the motif scoring at least as well as the observed match. - For each sequence, all motif occurrences are shown unless there are overlaps. In that case, a motif occurrence is shown only if its p-value is less than the product of the p-values of the other (lower-numbered) motif occurrences that it overlaps. - The table also shows the E-value of each sequence. - Spacers and motif occurences are indicated by o -d- `d' residues separate the end of the preceding motif occurrence and the start of the following motif occurrence o [sn] occurrence of motif `n' with p-value less than 0.0001. A minus sign indicates that the occurrence is on the reverse complement strand. ******************************************************************************** SEQUENCE NAME E-VALUE MOTIF DIAGRAM ------------- -------- ------------- ACC1 6.1e-05 82_[+1]_137_[+2]_559 CHO1 0.00016 152_[+2]_396_[-2]_42_[+1]_17_ [+1]_149 INO1 0.00019 282_[-2]_327_[-1]_55_[+1]_102 FAS1 0.00022 43_[+2]_41_[+1]_694 OPI3 0.00092 185_[-2]_144_[+1]_449 CHO2 0.0029 353_[+1]_47_[-2]_378 FAS2 0.0093 184_[-2]_372_[+1]_222 ******************************************************************************** ******************************************************************************** SECTION III: ANNOTATED SEQUENCES ******************************************************************************** - The positions and p-values of the non-overlapping motif occurrences are shown above the actual sequence for each of the high-scoring sequences from Section I. - A motif occurrence is defined as a position in the sequence whose match to the motif has POSITION p-value less than 0.0001 as defined in Section II. - For each sequence, the first line specifies the name of the sequence. - The second (and possibly more) lines give a description of the sequence. - Following the description line(s) is a line giving the length, combined p-value, and E-value of the sequence as defined in Section I. - The next line reproduces the motif diagram from Section II. - The entire sequence is printed on the following lines. - Motif occurrences are indicated directly above their positions in the sequence on lines showing o the motif number of the occurrence (a minus sign indicates that the occurrence is on the reverse complement strand), o the position p-value of the occurrence, o the best possible match to the motif (or its reverse complement), and o columns whose match to the motif has a positive score (indicated by a plus sign). ******************************************************************************** ACC1 sequence of the region upstream from YNR016C LENGTH = 800 COMBINED P-VALUE = 8.78e-06 E-VALUE = 6.1e-05 DIAGRAM: 82_[+1]_137_[+2]_559 [+1] 3.1e-07 TTCACATGCCGC ++++++++++ + 76 TAAAATCTTCACATGGCCCGGCCGCGCGCGCGTTGTGCCAACAAGTCGCAGTCGAAATTCAACCGCTCATTGCCA [+2] 7.4e-07 TCTGGCACAG ++++++++++ 226 TCGTATTCTGGCACAGTATAGCCTAGCACAATCACTGTCACAATTGTTATCGGTTCTACAATTGTTCTGCTCTCT CHO1 sequence of the region upstream from YER026C LENGTH = 800 COMBINED P-VALUE = 2.30e-05 E-VALUE = 0.00016 DIAGRAM: 152_[+2]_396_[-2]_42_[+1]_17_[+1]_149 [+2] 3.9e-05 TCTGGCACAG ++++++ + 151 CGTCTGGCGCCCTTCCCATTCCGAACCATGTTATATTGAACCATCTGGCGACAAGCAGTATTAAGCATAATACAT [-2] 7.4e-07 CTGTGCCAGA ++++++++++ 526 CAATCCCCACTCCTTCTCAATGTGTGCAGACTTCTGTGCCAGACACTGAATATATATCAGTAATTGGTCAAAATC [+1] [+1] 8.7e-07 2.2e-05 TTCACATGCCGC TTCACATGCCGC ++++++ +++ + +++++++++ + 601 ACTTTGAACGTTCACACGGCACCCTCACGCCTTTGAGCTTTCACATGGACCCATCTAAAGATGAAGATCCGTATT INO1 sequence of the region upstream from YJL153C LENGTH = 800 COMBINED P-VALUE = 2.71e-05 E-VALUE = 0.00019 DIAGRAM: 282_[-2]_327_[-1]_55_[+1]_102 [-2] 1.8e-05 CTGTGCCAGA +++ +++ ++ 226 ACGTTGTATATGAAACGAGTAGTGAACGTTCGTACGATCTTTCACGCAGACATGCGACTGCGCCCGCCGTAGACC [-1] 4.2e-08 GCGGCATGTGAA ++++++++++++ 601 TGCGCTTCGGCGGCTAAATGCGGCATGTGAAAAGTATTGTCTATTTTATCTTCATCCTTCTTTCCCAGAATATTG [+1] 1.3e-05 TTCACATGCCGC +++++++++ ++ 676 AACTTATTTAATTCACATGGAGCAGAGAAAGCGCACCTCTGCGTTGGCGGCAATGTTAATTTGAGACGTATATAA FAS1 sequence of the region upstream from YKL182W LENGTH = 800 COMBINED P-VALUE = 3.19e-05 E-VALUE = 0.00022 DIAGRAM: 43_[+2]_41_[+1]_694 [+2] 2.2e-05 TCTGGCACAG ++ +++++ + 1 CCGGGTTATAGCAGCGTCTGCTCCGCATCACGATACACGAGGTGCAGGCACGGTTCACTACTCCCCTGGCCTCCA [+1] 4.2e-08 TTCACATGCCGC ++++++++++++ 76 ACAAACGACGGCCAAAAACTTCACATGCCGCCCAGCCAAGCATAATTACGCAACAGCGATCTTTCCGTCGCACAA OPI3 sequence of the region upstream from YJR073C LENGTH = 800 COMBINED P-VALUE = 1.32e-04 E-VALUE = 0.00092 DIAGRAM: 185_[-2]_144_[+1]_449 [-2] 7.4e-07 CTGTGCCAGA ++++++++++ 151 GTTAATCTGATCAACGCTACGCCGATGACAACGGTCTGTGCCAGATCTGGTTTTCCCCACTTATTTGCTACTTCC [+1] 5.8e-06 TTCACATGCCGC ++++ ++ ++ + 301 AACTCCGTCAGGTCTTCCACGTGGAACTGCCAAGCCTCCTTCAGATCGCTCTTGTCGACCGTCTCCAAGAGATCC CHO2 sequence of the region upstream from YGR157W LENGTH = 800 COMBINED P-VALUE = 4.18e-04 E-VALUE = 0.0029 DIAGRAM: 353_[+1]_47_[-2]_378 [+1] 5.2e-07 TTCACATGCCGC +++ ++++++++ 301 ATATATATTTTTGCCTTGGTTTAAATTGGTCAAGACAGTCAATTGCCACACTTTTCTCATGCCGCATTCATTATT [-2] 2.9e-05 CTGTGCCAGA + +++++++ 376 CGCGAAGTTTTCCACACAAAACTGTGAAAATGAACGGCGATGCCAGAAACGGCAAAACCTCAAATGTTAGATAAC FAS2 sequence of the region upstream from YPL231W LENGTH = 800 COMBINED P-VALUE = 1.33e-03 E-VALUE = 0.0093 DIAGRAM: 184_[-2]_372_[+1]_222 [-2] 2.9e-05 CTGTGCCAGA ++++++++ 151 AACAGGGTGTCGGTCATACCGATAAAGCCGTCAAGAGTGCCAGAAAAGCAAGAAAGAACAAGATTAGATGTTGGT [+1] 1.9e-06 TTCACATGCCGC +++++++++ + 526 GCTTAGCAAAATCCAACCATTTTTTTTTTATCTCCCGCGTTTTCACATGCTACCTCATTCGCCTCGTAACGTTAC ******************************************************************************** CPU: pmgm2 Time 0.030000 secs. mast meme.INO_up800.oops.txt -text -stdout