from Bio.SeqUtils import CodonUsage import os import sys # first make a CAI object X = CodonUsage.CodonAdaptationIndex() # now generate an index from a file if os.path.exists("./CodonUsage/HighlyExpressedGenes.txt"): X.generate_index("./CodonUsage/HighlyExpressedGenes.txt") elif os.path.exists("./Tests/CodonUsage/HighlyExpressedGenes.txt"): X.generate_index("./Tests/CodonUsage/HighlyExpressedGenes.txt") else: print "Cannot find the file HighlyExpressedGene.txt\nMake sure you run the tests from within the Tests folder" sys.exit() # alternatively you could use any predefined dictionary like this: # from CaiIndices import SharpIndex # you can save your dictionary in this file. # X.SetCaiIndex(SharpIndex) print "The current index used:" X.print_index() print "-" * 60 print "codon adaptation index for test gene: %.2f" % X.cai_for_gene("ATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGA")