einverted Wiki The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki. Please help by correcting and extending the Wiki pages. Function Finds inverted repeats in nucleotide sequences Description einverted finds inverted repeats (stem loops) in nucleotide sequences. It identifies regions of local alignment of the input sequence and its reverse complement that exceed a threshold score. The alignments may include a proportion of mismatches and gaps, which correspond to bulges in the stem loop. One or more sequences are read and a file with the sequence(s) (without gap characters) of the inverted repeat regions is written. It can find multiple inverted repeats in a sequence. Only non-overlapping matches are reported. Algorithm einverted uses dynamic programming and thus is guaranteed to find optimal, local alignments between the sequence and its reverse complement. Matched bases contribute positively to the score whereas gaps and mismatches are penalised. The score for a local alignment is the sum of the values of each match, minus penalties for mismatches and gap insertion. Any region whose score exceeds the threshold is reported. The gap penalty, match score and mismatch score, and the threshold score for reporting regions, are all user-specified. Usage Here is a sample session with einverted % einverted tembl:d00596 Finds inverted repeats in nucleotide sequences Gap penalty [12]: Minimum score threshold [50]: Match score [3]: Mismatch score [-4]: Sanger Centre program inverted output file [d00596.inv]: File for sequence of regions of inverted repeats. [d00596.fasta]: Go to the input files for this example Go to the output files for this example Command line arguments Finds inverted repeats in nucleotide sequences Version: EMBOSS:6.4.0.0 Standard (Mandatory) qualifiers: [-sequence] seqall Nucleotide sequence(s) filename and optional format, or reference (input USA) -gap integer [12] Gap penalty (Integer 0 or more) -threshold integer [50] Minimum score threshold (Integer 0 or more) -match integer [3] Match score (Integer 0 or more) -mismatch integer [-4] Mismatch score (Integer up to 0) [-outfile] outfile [*.einverted] Sanger Centre program inverted output file [-outseq] seqout [.] The sequence of the inverted repeat regions without gap characters. Additional (Optional) qualifiers: -maxrepeat integer [2000] Maximum separation between the start of repeat and the end of the inverted repeat. (Integer 0 or more) Advanced (Unprompted) qualifiers: (none) Associated qualifiers: "-sequence" associated qualifiers -sbegin1 integer Start of each sequence to be used -send1 integer End of each sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -sformat1 string Input sequence format -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-outfile" associated qualifiers -odirectory2 string Output directory "-outseq" associated qualifiers -osformat3 string Output seq format -osextension3 string File name extension -osname3 string Base file name -osdirectory3 string Output directory -osdbname3 string Database name to add -ossingle3 boolean Separate file for each entry -oufo3 string UFO features -offormat3 string Features format -ofname3 string Features file name -ofdirectory3 string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write first file to standard output -filter boolean Read first file from standard input, write first file to standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages -version boolean Report version number and exit Input file format The input for einverted is a nucleotide sequence Input files for usage example 'tembl:d00596' is a sequence entry in the example nucleic acid database 'tembl' Database entry: tembl:d00596 ID D00596; SV 1; linear; genomic DNA; STD; HUM; 18596 BP. XX AC D00596; XX DT 17-JUL-1991 (Rel. 28, Created) DT 07-DEC-2007 (Rel. 94, Last updated, Version 6) XX DE Homo sapiens gene for thymidylate synthase, complete cds. XX KW . XX OS Homo sapiens (human) OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; OC Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; OC Homo. XX RN [1] RP 1-18596 RX PUBMED; 2243092. RA Kaneda S., Nalbantoglu J., Takeishi K., Shimizu K., Gotoh O., Seno T., RA Ayusawa D.; RT "Structural and functional analysis of the human thymidylate synthase RT gene"; RL J. Biol. Chem. 265(33):20277-20284(1990). XX DR GDB; 163670. DR GDB; 182340. XX CC These data kindly submitted in computer readable form by: CC Sumiko Kaneda CC National Institute of Genetics CC 1111 Yata CC Mishima 411 CC Japan XX FH Key Location/Qualifiers FH FT source 1..18596 FT /organism="Homo sapiens" FT /chromosome="18" FT /map="18p11.32" FT /mol_type="genomic DNA" FT /clone="lambdaHTS-1 and lambdaHTS-3" FT /db_xref="taxon:9606" FT repeat_region 1..148 FT /rpt_family="Alu" FT repeat_region 202..477 FT /rpt_family="Alu" FT prim_transcript 822..16246 FT /note="thymidylate synthase mRNA and introns" [Part of this file has been deleted for brevity] ttttgttttt agcttcagcg agaacccaga cctttcccaa agctcaggat tcttcgaaaa 15660 gttgagaaaa ttgatgactt caaagctgaa gactttcaga ttgaagggta caatccgcat 15720 ccaactatta aaatggaaat ggctgtttag ggtgctttca aaggagctcg aaggatattg 15780 tcagtcttta ggggttgggc tggatgccga ggtaaaagtt ctttttgctc taaaagaaaa 15840 aggaactagg tcaaaaatct gtccgtgacc tatcagttat taatttttaa ggatgttgcc 15900 actggcaaat gtaactgtgc cagttctttc cataataaaa ggctttgagt taactcactg 15960 agggtatctg acaatgctga ggttatgaac aaagtgagga gaatgaaatg tatgtgctct 16020 tagcaaaaac atgtatgtgc atttcaatcc cacgtactta taaagaaggt tggtgaattt 16080 cacaagctat ttttggaata tttttagaat attttaagaa tttcacaagc tattccctca 16140 aatctgaggg agctgagtaa caccatcgat catgatgtag agtgtggtta tgaactttaa 16200 agttatagtt gttttatatg ttgctataat aaagaagtgt tctgcattcg tccacgcttt 16260 gttcattctg tactgccact tatctgctca gttccttcct aaaatagatt aaagaactct 16320 ccttaagtaa acatgtgctg tattctggtt tggatgctac ttaaaagagt atattttaga 16380 aataatagtg aatatatttt gccctatttt tctcatttta actgcatctt atcctcaaaa 16440 tataatgacc atttaggata gagttttttt tttttttttt taaactttta taaccttaaa 16500 gggttatttt aaaataatct atggactacc attttgccct cattagcttc agcatggtgt 16560 gacttctcta ataatatgct tagattaagc aaggaaaaga tgcaaaacca cttcggggtt 16620 aatcagtgaa atatttttcc cttcgttgca taccagatac ccccggtgtt gcacgactat 16680 ttttattctg ctaatttatg acaagtgtta aacagaacaa ggaattattc caacaagtta 16740 tgcaacatgt tgcttatttt caaattacag tttaatgtct aggtgccagc ccttgatata 16800 gctatttttg taagaacatc ctcctggact ttgggttagt taaatctaaa cttatttaag 16860 gattaagtag gataacgtgc attgatttgc taaaagaatc aagtaataat tacttagctg 16920 attcctgagg gtggtatgac ttctagctga actcatcttg atcggtagga ttttttaaat 16980 ccatttttgt aaaactattt ccaagaaatt ttaagccctt tcacttcaga aagaaaaaag 17040 ttgttggggc tgagcactta attttcttga gcaggaagga gtttcttcca aacttcacca 17100 tctggagact ggtgtttctt tacagattcc tccttcattt ctgttgagta gccgggatcc 17160 tatcaaagac caaaaaaatg agtcctgtta acaaccacct ggaacaaaaa cagattttat 17220 gcatttatgc tgctccaaga aatgctttta cgtctaagcc agaggcaatt aattaatttt 17280 tttttttttg acatggagtc actgtccgtt gcccaggctg cagtgcagtg gcgcaatctt 17340 ggctcactgc aacctccacc tcccaggttc aagtgattct cctgcctcag cctcccatgt 17400 agctgggatc acaggcacct gccaccatgc ccggctaatt ttttgtattt tttgtagaga 17460 cagggtttca ccatgttggc caggctggtc tcaaacacct gacctcaaat gatccacctg 17520 cctcagcctc ccaaagtgtt gggattacag gcgtaagcca ccatgcccag ccctgaatta 17580 atatttttaa aataagtttg gagactgttg gaaataatag ggcagaggaa catattttac 17640 tggctacttg ccagagttag ttaactcatc aaactctttg ataatagttt gacctctgtt 17700 ggtgaaaatg agccatgatc tcttgaacat gatcagaata aatgccccag ccacacaatt 17760 gtagtccaaa ctttttaggt cactaacttg ctagatggtg ccaggttttt ttgcacaagg 17820 agtgcaaatg ttaagatctc cactagtgag gaaaggctag tattacagaa gccttgtcag 17880 aggcaattga acctccaagc cctggccctc aggcctgagg attttgatac agacaaactg 17940 aagaaccgtt tgttagtgga tattgcaaac aaacaggagt caaagcttgg tgctccacag 18000 tctagttcac gagacaggcg tggcagtggc tggcagcatc tcttctcaca ggggccctca 18060 ggcacagctt accttgggag gcatgtagga agcccgctgg atcatcacgg gatacttgaa 18120 atgctcatgc aggtggtcaa catactcaca caccctagga ggagggaatc agatcggggc 18180 aatgatgcct gaagtcagat tattcacgtg gtgctaactt aaagcagaag gagcgagtac 18240 cactcaattg acagtgttgg ccaaggctta gctgtgttac catgcgtttc taggcaagtc 18300 cctaaacctc tgtgcctcag gtccttttct tctaaaatat agcaatgtga ggtggggact 18360 ttgatgacat gaacacacga agtccctctg agaggttttg tggtgccctt taaaagggat 18420 caattcagac tctgtaaata tccagaatta tttgggttcc tctggtcaaa agtcagatga 18480 atagattaaa atcaccacat tttgtgatct atttttcaag aagcgtttgt attttttcat 18540 atggctgcag cagctgccag gggcttgggg tttttttggc aggtagggtt gggagg 18596 // Output file format Output files for usage example File: d00596.fasta >D00596_13_142 gctacgcgagaggctgaggcagcagaattacttgaacccaggaggcggaggttgcagtga gccgagatcgcgccactgcactccagcctgggtgagagagcgagactctgtctcaaaaaa aaaaaaaaaa >D00596_199_328 ttttttttttttttttttgggacagtcttgctctgtcgcccaggctggagtacaatggtc ggatcttggctcactgcaacctctgcctcccaggttcaagcaattcttctgcctcagcct cccaagtagc >D00596_12128_12301 agaggatttttttttttttttttttttttgagacagagttttgctctgttgcccaggctg gaatgcaacggcgtgatcttggctcactgtaacctctgcctcctgggttcgagtgattct cctgcctcagcctccaagtagctgggattacagcatgtgccaccatgcctggct >D00596_12573_12749 agccaggtgtggtggctcacacctgtaattccaacaactccagaggccaaggcgagagga tcatttgaacccacggaatttgaggctgtagtgagtcatgatcacgccattgcactccat cctgggcaacagagtgagaccctgaatatttaaaaacaacaacaacaacaaaactct >D00596_12246_12296 ctcctgcctcagcctccaagtagctgggattacagcatgtgccaccatgcc >D00596_13886_13938 ggtatggtggctcatgcctgtaatcccagcactttggaagactgagacaggag >D00596_13884_13949 tgggtatggtggctcatgcctgtaatcccagcactttggaagactgagacaggagcaatt gcttga >D00596_14628_14692 tcaagcaattcttctgcctcagcctcccaggtagctgggattacaggcacatgccaccac accca File: d00596.inv D00596: Score 236: 108/130 ( 83%) matches, 0 gaps 13 gctacgcgagaggctgaggcagcagaattacttgaacccaggaggcggaggttgcagtgagccgagatcgc gccactgcactccagcctgggtgagagagcgagactctgtctcaaaaaaaaaaaaaaaa 142 ||||| | ||||||||||||| |||||| |||||||| |||||| |||||||||||||||| ||||| ||| || ||||||||||||| || ||||| ||||| | | |||||||||||||||| 328 cgatgaaccctccgactccgtcttcttaacgaacttggaccctccgtctccaacgtcactcggttctaggc tggtaacatgaggtcggacccgctgtctcgttctgacagggtttttttttttttttttt 199 D00596: Score 164: 128/174 ( 73%) matches, 3 gaps 12128 agaggatttttttttttttttttttttttgagacagagttttgctctgttgcccaggctggaatgcaacgg cgtgatcttggctcactgtaacctctgcctcc-tgggttcgagtgattctcctgcctcagcctc-caagtagctgggatt aca-gcatgtgccaccatgcctggct 12301 |||| || || || || || ||||| | ||| || | |||||||||||||| |||| ||||| || ||||||| || |||||| | |||| ||| ||||||| | |||| ||| |||| ||||| ||| | ||| ||| ||| | || ||||||| ||||||| 12749 tctcaaaacaacaacaacaacaaaaatttataagtcccagagtgagacaacgggtcctacctcacgttacc gcactagtactgagtgatgtcggagtttaaggcacccaagtttactaggagagcggaaccggagacctcaacaaccttaa tgtccacactcggtggtgtggaccga 12573 D00596: Score 80: 44/51 ( 86%) matches, 2 gaps 12246 ctcctgcctcag-cctccaagtagctgggattaca-gcatgtgccaccatgcc 12296 |||||| ||||| | ||||| |||||||||||| ||||| |||||||| || 13938 gaggacagagtcagaaggtttcacgaccctaatgtccgtactcggtggtatgg 13886 D00596: Score 99: 53/65 ( 81%) matches, 1 gaps 13884 tgggtatggtggctcatgcctgtaatcccagcactttggaagactgagacaggagcaattgcttga 1394 9 ||||| ||||||| |||||||||||||||| ||| || ||||| ||| || |||||||||| 14692 acccacaccaccgtacacggacattagggtcgatggaccctccgactccgtcttc-ttaacgaact 1462 8 Data files None. Notes The original "inverted" program (from which einverted was derived) was used to annotate the nematode genome. Excluding overlapping repeats saved problems with simple repeat sequences in this genome. einverted will find optimal alignments but is slower than heuristic methods such as BLAST. Sometimes you can find repeats using the program palindrome that you can't find with einverted using the default parameters. This is not due to a problem with either program. It is simply because some of the shortest repeats that you find with palindrome's default parameter values are below einverted's default cutoff score - you should decrease the 'Minimum score threshold' to see them. For example, when palindrome is run with 'em:x65921', it finds the repeat: 64 aaaactaaggc 74 ||||||||||| 98 ttttgattccg 88 einverted will not report this as its score is 33 (11 bases scoring 3 each, no mismatches or gaps) which is below the default score cutoff of 50. If einverted is run as: % einverted em:x65921 -threshold 30 then it will find it: Score 33: 11/11 (100%) matches, 0 gaps 64 aaaactaaggc 74 ||||||||||| 98 ttttgattccg 88 Anything can be considered to be a repeat if you set the score threshold low enough! einverted does not report overlapping matches. References Some useful references on inverted repeats: 1. Pearson CE, Zorbas H, Price GB, Zannis-Hadjopoulos M Inverted repeats, stem-loops, and cruciforms: significance for initiation of DNA replication. J Cell Biochem 1996 Oct;63(1):1-22 2. Waldman AS, Tran H, Goldsmith EC, Resnick MA. q Long inverted repeats are an at-risk motif for recombination in mammalian cells. Genetics. 1999 Dec;153(4):1873-83. PMID: 10581292; UI: 20050682 3. Jacobsen SE Gene silencing: Maintaining methylation patterns. Curr Biol 1999 Aug 26;9(16):R617-9 4. Lewis S, Akgun E, Jasin M. Palindromic DNA and genome stability. Further studies. Ann N Y Acad Sci. 1999 May 18;870:45-57. PMID: 10415472; UI: 99343961 5. Dai X, Greizerstein MB, Nadas-Chinni K, Rothman-Denes LB Supercoil-induced extrusion of a regulatory DNA hairpin. Proc Natl Acad Sci U S A 1997 Mar 18;94(6):2174-9 Warnings None. Diagnostic Error Messages None. Exit status It always exits with a status of 0. Known bugs None. See also Program name Description banana Plot bending and curvature data for B-DNA btwisted Calculate the twisting in a B-DNA sequence equicktandem Finds tandem repeats in nucleotide sequences etandem Finds tandem repeats in a nucleotide sequence palindrome Finds inverted repeats in nucleotide sequence(s) sirna Finds siRNA duplexes in mRNA palindrome also looks for inverted repeats but is much faster and less sensitive, as it looks for near-perfect repeats. Author(s) This program was originally written by Richard Durbin Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK. Please report all bugs to the EMBOSS bug team (emboss-bug (c) emboss.open-bio.org) not to the original author. This application was modified for inclusion in EMBOSS by Peter Rice European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK Please report all bugs to the EMBOSS bug team (emboss-bug (c) emboss.open-bio.org) not to the original author. History Written (1999) - Peter Rice Target users This program is intended to be used by everyone and everything, from naive users to embedded scripts. Comments None