seqretsplit Wiki The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki. Please help by correcting and extending the Wiki pages. Function Reads sequences and writes them to individual files Description seqretsplit is a variant of the standard program for reading and writing sequences, seqret. It performs exactly the same function except that when it reads more than one sequence, it writes each sequence to an individual file. In all other respects, skipseq is the same as seqret. Its main use is therefore to split a file containing multiple sequences into many files, each containing one sequence. There are many options built-in into EMBOSS for detailed specification of the input and output sequences, for example the sequence type and file format. Optionally, feature information will be read and written. Usage Here is a sample session with seqretsplit % seqretsplit tembl:m1190* Reads sequences and writes them to individual files output sequence(s) [m11903.fasta]: Go to the input files for this example Go to the output files for this example The specification of the output file is not used in this case. At some point this ought to change and you will not be prompted for the output file at all. Command line arguments Reads sequences and writes them to individual files Version: EMBOSS:6.4.0.0 Standard (Mandatory) qualifiers: [-sequence] seqall (Gapped) sequence(s) filename and optional format, or reference (input USA) [-outseq] seqoutall [.] Sequence set(s) filename and optional format (output USA) Additional (Optional) qualifiers: (none) Advanced (Unprompted) qualifiers: -feature boolean Use feature information -firstonly boolean Read one sequence and stop Associated qualifiers: "-sequence" associated qualifiers -sbegin1 integer Start of each sequence to be used -send1 integer End of each sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -sformat1 string Input sequence format -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-outseq" associated qualifiers -osformat2 string Output seq format -osextension2 string File name extension -osname2 string Base file name -osdirectory2 string Output directory -osdbname2 string Database name to add -ossingle2 boolean Separate file for each entry -oufo2 string UFO features -offormat2 string Features format -ofname2 string Features file name -ofdirectory2 string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write first file to standard output -filter boolean Read first file from standard input, write first file to standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages -version boolean Report version number and exit Input file format seqretsplit reads one or more nucleotide or protein sequences. The input is a standard EMBOSS sequence query (also known as a 'USA'). Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application. The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug. See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats. Input files for usage example 'tembl:m1190*' is a sequence entry in the example nucleic acid database 'tembl' Output file format The output is a standard EMBOSS sequence file. The results can be output in one of several styles by using the command-line qualifier -osformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq, excel, feattable, motif, nametable, regions, seqtable, simple, srs, table, tagseq. See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats. Output files for usage example File: m11903.fasta >M11903 M11903.1 Rattus norvegicus androgen-responsive protein precursor (Svf) g ene, exons 1 and 1A, alternatively spliced. cctttcaaatagaaactctcgtgaaggctgtctgagaacacaagctcaaggttgtgactg atttcagtgatgccgtcttgaagagggataccgtgctagagaatgactcctgatcaaccc tgaagacttctgcaagcccgaagtcgtgcttccccactctgaactgacatatgttcagga agtagagacgtgcaccgttggatgttctcaaggtaaaaaggaagatttggaagaatgctc tagtgttgttgccttggagaggaccagggaacagtacaagactcctactgagcagagaga aaggagcctgacatttaccgataagaaaggtcatttgccttccaacctgtaggcaaggcc agacaaggaaatatataaaggagaacctcagatcagctctcagtcaagacccttcctgac aagatgagtcccaccgggttcttcctccttacggtgctccttgttctggtgacagaagca gcctcgagggggccccgaggtgagtggcaattttgtgctatgggaaagatgtttgagaac tatgttctcaaaagggagtctgcagaatgctgtgttcccagggcttctccatgaaggaaa cttgagtcttttcaagctttaaccatagtcctactgtgagtctctgtgacttgacaagca acattgctggtaaggagggctgagggggaatgcgggcaacggcctcgggtaacatcctca ttgt File: m11904.fasta >M11904 M11904.1 Rattus norvegicus androgen-responsive protein precursor (Svf) g ene, exon 2 and complete cds. ggtatctccaaacacagcagctggctctcaacagagagtcctcatgcacaactaatccaa gatacagaaagtggatatagagaatgagacattgttttctctcaacagaaaaattctcac agtcagctgaagacccttatagtgaaaacatgaatctaaagattctggcgagcgggaggg gatcaagttctacctttggggcattcagccgaagtgagaactctcggagtaacttcaaat caaaaagtccaagcagtatcaccagggagaaagtgaatgaggaaagcaggagtgaaatga gtagtaccagcagccattttggtctcaaaatgagaagatctcatggaggaggagaaatga atccctttgaaaccaaagtaaagacccggatcactcgcaaataatgtgttccccggccaa ctgaagacttgagcccaataggcaggtaagtgttatcaccaggtgagggcttacaaacta ctcgtgcctaatccctaggccattgtaggattgtgcacgcagtaaagttgctataagggg aggtatggaaacgacctacaaggcagacaaagatacgagctatactgtgt File: m11905.fasta >M11905 M11905.1 Rattus norvegicus androgen-responsive protein precursor (Svf) g ene, exon 3. ccgtgcaatctcttcctgtgtccacacagccctgttagaagcaactctctcgttctcaag gccctacctgcaagaactacctttctcttcctccgcccaacaaaggaggaatgtttctgc ttgtgacccaccagagatgaaatatagcagtgtcctgcagtaaaggggggccccagaggc atgggacatacacgcattaatccctccacgtcttccctgtcctacctcacaggttgtcct cgttccctgggtgtcactgaactaagagaagtctatgatgtcttcaggatgcaggatccc acaggtgccccggaaatagtccgtgcttcttatttcctccttacacttgttttctttaag attccggaacctgacaagattcaaatttaaccttttcaataaaaaagatactattctgca tcattatctcctgaaatctcttgcttctgcagtacaggggctgggtgggattcctaaact tgaccagttctgccgttaaaggaagatcccttctgtgccgtatcagagactatttccaga ctctggataga One file for each input sequence is written out. The names of the files it creates are derived from the ID name of the sequence, followed by an extension denoting the format of the sequence. You have no control over the names of the files it writes out. For example, if the files embl:hsfa11* are read in and the output is specified as wibble.seq, then the following files are expected to be created: hsfa110.fasta hsfa111.fasta hsfa112.fasta hsfa113.fasta hsfa114.fasta (No file wibble.seq is created.) Data files None. Notes See the documentation for seqret to see the full range of things that you can do when reading and writing sequences. Some non-EMBOSS programs will accept only single sequences. In such cases seqretsplit is useful for splitting a multiple sequence file into many individual files. Some EMBOSS programs will also read only a single sequence, which may, however, be one of many in a file. You can specify the sequence using the USA filename:sequenceID. Nonetheless, some people feel more comfortable handling one sequence per file, so seqretsplit will be useful to them too. One file for each input sequence is written. The names of the files it creates are derived from the ID name of the sequence, followed by an extension denoting the format of the sequence. You have no control over the names of the files it writes out. For example, if the files embl:hsfa11* are read in and the output is specified as wibble.seq, then the following files are expected to be created: hsfa110.fasta hsfa111.fasta hsfa112.fasta hsfa113.fasta hsfa114.fasta (No file wibble.seq is created.) References None. Warnings None. Diagnostic Error Messages None. Exit status It always exits with status 0. Known bugs It shouldn't really prompt for the output filename. This is a side effect of the way sequence output works in EMBOSS. Writing multiple sequences to separate files (the -ossingle qualifier) does this, and seqretsplit has set it automatically on. See also Program name Description aligncopy Reads and writes alignments aligncopypair Reads and writes pairs from alignments biosed Replace or delete sequence sections codcopy Copy and reformat a codon usage table cutseq Removes a section from a sequence degapseq Removes non-alphabetic (e.g. gap) characters from sequences descseq Alter the name or description of a sequence entret Retrieves sequence entries from flatfile databases and files extractalign Extract regions from a sequence alignment extractfeat Extract features from sequence(s) extractseq Extract regions from a sequence featcopy Reads and writes a feature table featreport Reads and writes a feature table feattext Return a feature table original text listor Write a list file of the logical OR of two sets of sequences makenucseq Create random nucleotide sequences makeprotseq Create random protein sequences maskambignuc Masks all ambiguity characters in nucleotide sequences with N maskambigprot Masks all ambiguity characters in protein sequences with X maskfeat Write a sequence with masked features maskseq Write a sequence with masked regions newseq Create a sequence file from a typed-in sequence nohtml Remove mark-up (e.g. HTML tags) from an ASCII text file noreturn Remove carriage return from ASCII files nospace Remove whitespace from an ASCII text file notab Replace tabs with spaces in an ASCII text file notseq Write to file a subset of an input stream of sequences nthseq Write to file a single sequence from an input stream of sequences nthseqset Reads and writes (returns) one set of sequences from many pasteseq Insert one sequence into another revseq Reverse and complement a nucleotide sequence seqcount Reads and counts sequences seqret Reads and writes (returns) sequences seqretsetall Reads and writes (returns) many sets of sequences sizeseq Sort sequences by size skipredundant Remove redundant sequences from an input set skipseq Reads and writes (returns) sequences, skipping first few splitsource Split sequence(s) into original source sequences splitter Split sequence(s) into smaller sequences trimest Remove poly-A tails from nucleotide sequences trimseq Remove unwanted characters from start and end of sequence(s) trimspace Remove extra whitespace from an ASCII text file union Concatenate multiple sequences into a single sequence vectorstrip Removes vectors from the ends of nucleotide sequence(s) yank Add a sequence reference (a full USA) to a list file Author(s) Peter Rice European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK Please report all bugs to the EMBOSS bug team (emboss-bug (c) emboss.open-bio.org) not to the original author. History Written (Jan 2000) - Peter Rice Target users This program is intended to be used by everyone and everything, from naive users to embedded scripts. Comments The specification of the output file is not used when the output file names are generated automatically.. At some point this ought to change and you will not be prompted for the output file at all.