# Genetic Code Table
#
# Obtained from: http://www3.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi
#
#   Version 3.1 - 1995
#      Initial base data set from Andrzej Elzanowski (PIR/NCBI)
#
# Differences from the Standard Code: 
# 
#           Code 13     Standard
# 
#  AGA      Gly  G        Arg  R
#  AGG      Gly  G        Arg  R
#  AUA      Met  M        Ile  I
#  UGA      Trp  W        Ter  *
# 
# 
# Systematic Range and Comments: 
# 
# There is evidence from a phylogenetically diverse sample of tunicates
# (Urochordata) that AGA and AGG code for glycine.  In other organisms,
# AGA/AGG code for either arginine or serine and in vertebrate
# mitochondria they code a STOP.  Evidence for glycine translation of
# AGA/AGG has been found in Pyura stolonifera (Durrheim et al.  1993),
# Halocynthia roretzi (Kondow et al.  1999, Yokobori et al., 1993,
# Yokobori et al.  1999) and Ciona savignyi (Yokobori et al.  2003).  In
# addition, the Halocynthia roretzi mitochondrial genome encodes an
# additional tRNA gene with the anticodon U*CU that is thought to enable
# the use of AGA or AGG codons for glycine and the gene has been shown to
# be transcribed in vivo (Kondow et al.  1999, Yokobori et al.  1999). 


Genetic Code [13]

Ascidian Mitochondrial
  
AAs  =   FFLLSSSSYY**CCWWLLLLPPPPHHQQRRRRIIMMTTTTNNKKSSGGVVVVAAAADDEEGGGG
Starts = -----------------------------------M----------------------------
Base1  = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
Base2  = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
Base3  = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG