# Genetic Code Table # # Obtained from: http://www3.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi # # Version 3.1 - 1995 # Initial base data set from Andrzej Elzanowski (PIR/NCBI) # # Differences from the Standard Code: # # Code 14 Standard # # AAA Asn N Lys K # AGA Ser S Arg R # AGG Ser S Arg R # UAA Tyr Y Ter * # UGA Trp W Ter * # # # Systematic Range: # # Platyhelminthes (flatworms) # # Comments: # # Code 14 differs from code 9 only by translating UAA to Tyr rather than # STOP. A recent study [PMID:11027335] has found no evidence that the # codon UAA codes for Tyr in the flatworms but other opinions exist. # There are very few GenBank records that are translated with code 14 but # a test translation shows that retranslating these records with code 9 # can cause premature terminations. Therefore, GenBank will maintain code # 14 until further information become available. Genetic Code [14] Alternative Flatworm Mitochondrial AAs = FFLLSSSSYYY*CCWWLLLLPPPPHHQQRRRRIIIMTTTTNNNKSSSSVVVVAAAADDEEGGGG Starts = -----------------------------------M---------------------------- Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG