# Genetic Code Table
#
# Obtained from: http://www3.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi
#
#  Version 3.5
#     Added code 21, Trematode Mitochondrial
#       (as deduced from: Garey & Wolstenholme,1989; Ohama et al, 1990)
#
# Systematic Range:
#
# Trematoda: Ohama, T, S.  Osawa, K.  Watanabe, T.H.  Jukes, 1990.  J. 
# Molec Evol.  30 Garey, J.R.  and D.R.  Wolstenholme, 1989.  J.  Molec. 
# Evol.  28: 374-387 329-332. 
# 
# Other Alternative Initiation Codons
#
# GUG, UUG (and possibly CUG) in the Archaea (Noelling et al., unpublished) 
#
# AUA, GUG, UUG, and AUC or AAG may be used (at least in experimental
# systems) by the yeasts Saccharomyces cerevisiae (Olsen, 1987, and references
# therein). 
#
# ACG initiates translation of certain proteins in the adeno-associated virus
# type 2 (Becerra et al., 1985), the phage T7 mutant CR17 (Anderson and
# Buzash-Pollert, 1985), Sendai virus (Gupta and Patwardhan, 1988), and rice
# chloroplast (Hiratsuka et al., 1989). Also, it is the most effective non-AUG
# initiation codon in mammalin cells (Koepke and Leggatt, 1991). 
#
# CUG is the initiation codon for one of the two alternative products of the
# human c-myc gene (Hann et al., 1987). 
#

Genetic Code [21]

Trematode Mitochondrial

AAs  =   FFLLSSSSYY**CCWWLLLLPPPPHHQQRRRRIIMMTTTTNNNKSSSSVVVVAAAADDEEGGGG
Starts = -----------------------------------M---------------M------------
Base1  = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
Base2  = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
Base3  = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG