last-split ========== last-split finds "split alignments" (typically for DNA) or "spliced alignments" (typically for RNA). It reads candidate alignments of query sequences to a genome, and cuts from them a unique best alignment for each part of each query. This is useful for DNA queries that cross rearrangement breakpoints, or RNA queries that cross splice junctions. For a detailed explanation of what last-split does, please see `A survey of localized sequence rearrangements in human DNA `_ (update in `A pipeline for complete characterization of complex germline rearrangements from long DNA reads `_). The algorithm, and application to whole genomes, is in `Split-alignment of genomes finds orthologies more accurately `_. Examples -------- Split alignment of DNA reads to a genome ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Assume the DNA reads are in a file called "q.fastq" (in fastq-sanger format), and the genome is in "genome.fasta" (in fasta format). We can do the alignment like this:: lastdb -uNEAR db genome.fasta last-train -Q1 db q.fastq > train.out lastal -p train.out db q.fastq | last-split > out.maf Spliced alignment of RNA reads to a genome ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Now we assume that "q.fastq" has reads from RNA forward (sense) strands. This time, we provide the genome information to last-split, which causes it to do spliced instead of split alignment, and also tells it where the splice signals are (GT, AG, etc):: lastal -p train.out -D10 db q.fastq | last-split -g db > out.maf This will favor splices starting at GT (and to a lesser extent GC and AT), and ending at AG (and to a lesser extent AC). The output shows the donor (``don``) and acceptor (``acc``) dinucleotides. It also favors splices with introns of typical length, specified by a log-normal distribution (cis-splices). However, it allows arbitrary trans-splices between any two places in the genome. ``-D10`` sets a very loose significance threshold, so that we can find very short parts of a spliced alignment (e.g. short exons). Note that last-split discards the lowest-significance alignments, but it uses them to estimate the ambiguity of higher-significance alignments. If your reads are from unknown/mixed RNA strands, add ``-d2`` to the last-split options. Alignment of two whole genomes ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ See the cookbook_. Output ------ The output is in MAF(-like) format:: a score=150 mismap=0.000413 s chr21 15963638 25 + 48129895 TCAGATGAGGACCTAATTTATTACT s query7 50 25 + 75 TCAGATGAGGACCTAATTTATTACT q query7 EBEEC@CE=EEE?FEDAED5?@@D@ p !#$'BBBBBBBBBBBBBBBBBBBBB The "mismap" is the estimated probability that this part of the query should be aligned to a different part of the genome. The line starting with "p" (shown by option ``-fMAF+``) indicates the probability that each base should be aligned to a different part of the genome. It uses a compact code: ====== ================= ====== ================= Symbol Error probability Symbol Error probability ====== ================= ====== ================= ``!`` 0.79 -- 1 ``0`` 0.025 -- 0.032 ``"`` 0.63 -- 0.79 ``1`` 0.02 -- 0.025 ``#`` 0.5 -- 0.63 ``2`` 0.016 -- 0.02 ``$`` 0.4 -- 0.5 ``3`` 0.013 -- 0.016 ``%`` 0.32 -- 0.4 ``4`` 0.01 -- 0.013 ``&`` 0.25 -- 0.32 ``5`` 0.0079 -- 0.01 ``'`` 0.2 -- 0.25 ``6`` 0.0063 -- 0.0079 ``(`` 0.16 -- 0.2 ``7`` 0.005 -- 0.0063 ``)`` 0.13 -- 0.16 ``8`` 0.004 -- 0.005 ``*`` 0.1 -- 0.13 ``9`` 0.0032 -- 0.004 ``+`` 0.079 -- 0.1 ``:`` 0.0025 -- 0.0032 ``,`` 0.063 -- 0.079 ``;`` 0.002 -- 0.0025 ``-`` 0.05 -- 0.063 ``<`` 0.0016 -- 0.002 ``.`` 0.04 -- 0.05 ``=`` 0.0013 -- 0.0016 ``/`` 0.032 -- 0.04 ``>`` 0.001 -- 0.0013 ====== ================= ====== ================= Other symbols indicate lower error probabilities, and "~" is the lowest possible. In general:: Error probability <= 10 ^ -((ASCII value - 33) / 10) The "mismap" is simply the lowest probability from the "p" line. (If you run last-split twice, as in the genome alignment recipes, the mismap is the lowest combined error probability from both "p" lines.) Tips ---- To omit alignments with mismap probability > ``10^-6`` (say), you can use the ``-m`` option (see below), or do this:: awk -F= '/^a/ {i = $3 <= 1e-6} i' out.maf > out2.maf FAQ --- :Q: Before aligning RNA, should poly-A tails be trimmed? :A: It's not essential, but it might make things faster. Poly-A tracts tend to have many matches in the genome. By trimming, you can prevent lastal and last-split from wasting time on such matches. Split versus spliced alignment ------------------------------ Here is a split alignment:: Query ttctttgat--gctagtcctgatgttatggtattttttatcgaatgataa |||||||--|||||| |||x|||||||||||| Genome chrA ...ctttgatatgctagt... |||x|||||||||||| Genome chrB ...tttatatcgaatgata... And here is a spliced alignment:: Query ctagtcgatatt--gctgtacgtctgttagctat-tttttcctctgtttg |||x|||||--|||||||||----|||||||-|||||x||||| Genome chrA ...gtctatattatgctgtacgt... |||||||-|||||x||||| Genome chrB ...tagctatattttttctctg... Split alignment allows arbitrarily large unaligned parts in the middle of the query, whereas spliced alignment applies a standard gap penalty. (Both allow arbitrarily large unaligned parts at the edges of the query.) Specialized examples -------------------- Faster spliced alignment ~~~~~~~~~~~~~~~~~~~~~~~~ Spliced alignment can be slow. It can be sped up, at a small cost in accuracy, by not favoring cis-splices:: lastal -p train.out -D10 db q.fastq | last-split -c0 -t0.004 -g db > out.maf The ``-c0`` turns off cis-splicing, and the ``-t0.004`` specifies a higher probability of "trans-splicing" (which includes cis-splicing, just doesn't favor it). "Spliced" alignment of DNA reads to a genome ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ If we do not wish to allow arbitrarily large unaligned parts in the middle of the query, we can do "spliced" alignment without considering splice signals or favoring cis-splices:: lastal -p train.out db q.fastq | last-split -c0 > out.maf Options ------- -h, --help Show a help message, with default option values, and exit. -f, --format=FMT Choose the output format: ``MAF`` (without "p" lines), or ``MAF+`` (with "p" lines). The format name is not case-sensitive. The default is ``MAF`` (unless the input alignments have "p" lines from ``lastal -j``, in which case the default is ``MAF+``). -r, --reverse Reverse the roles of the 2 sequences in each alignment: use the 1st (top) sequence as the "query" and the 2nd as the "reference". -g, --genome=NAME Do spliced alignment, and read splice signals (GT, AG, etc) from the named genome. NAME should be the name of a lastdb database. -d, --direction=D Do spliced alignment, and set the strandedness of the queries: 0=antisense, 1=sense, 2=unknown/mixed. This determines whether forward and/or reverse-complement splice signals are used. If you use ``-d2``, the output will have an extra ``sense`` field, indicating the log-odds that the query is sense-stranded:: log2[ prob(sense) / prob(antisense) ] The donor and acceptor annotations also indicate strandedness. This order means that the query sequence is from the forward strand of a spliced RNA:: don acc don acc don acc And this order means it is from the reverse strand:: acc don acc don acc don It's possible for ``don`` and ``acc`` to conflict with ``sense``. That happens if one orientation is overall more likely (indicated by ``sense``), but any one alignment with that orientation is not the most likely. -c, --cis=PROB Do spliced alignment, and set the average probability per base of cis-splicing. The default value roughly fits human RNA. -t, --trans=PROB Do spliced alignment, and set the average probability per base of trans-splicing. -M, --mean=MEAN Do spliced alignment, and set the mean of ln(intron length). The default value fits human RNA. -S, --sdev=SDEV Do spliced alignment, and set the standard deviation of ln(intron length). The default value fits human RNA. -m, --mismap=PROB Don't write alignments with mismap probability > PROB. -s, --score=INT Don't write alignments with score < INT. For SPLIT alignment, the default value is e (the lastal score threshold). Alignments with score just above INT will get high mismap probabilities. For SPLICED alignment, the default value is e + t * ln(100), where t is a scale factor that is written in the lastal header. This roughly means that, for every alignment it writes, it has considered alternative alignments with one-hundredth the probability. Alignments with score just above INT will not necessarily get high mismap probabilities. -n, --no-split Do probability calculations as usual, but write the *original* alignments, annotated with "p" lines and mismap probabilities. Note that the mismap and score limits still apply. -b, --bytes=B Skip any query sequence that would require more than B bytes of memory to process. (This only limits the size of some core data-structures: the total memory use will be greater.) A warning is written for each skipped sequence. You can use suffixes such as K (KibiBytes), M (MebiBytes), G (GibiBytes), T (TebiBytes), e.g. ``-b20G``. -v, --verbose Show progress information on the screen. -V, --version Show version information and exit. Details ------- * The input must be in MAF format, and it must include header lines (of the kind produced by lastal) describing the alignment score parameters. * The input must not mix alignments of different query sequences. In other words, all the alignments of one query must be next to each other. If you use ``-r``/``--reverse``, however, there is no such requirement, and the whole input gets read into memory. * lastal can optionally write "p" lines, indicating the probability that each base is misaligned due to wrong gap placement. last-split, on the other hand, writes "p" lines indicating the probability that each base is aligned to the wrong genomic locus. You can combine both sources of error (roughly) by taking the maximum of the two error probabilities for each base. Limitations ----------- last-split does not support: * DNA-versus-protein alignments. * Generalized affine gap costs. To do ----- * An option to specify splice signals and their strengths. .. _cookbook: doc/last-cookbook.rst