PLNT2530 PLANT BIOTECHNOLOGY

Assignment 4 - 2024

This assignment is worth 5% of the course grade.
Due by 11:59 pm, Monday April 8

Inside your PLNT2530 directory, create a sub-directory called as4, to hold materials associated with Assignment 4.

We will be working with the PCR product generated in the In-silico PCR by PrimerBLAST tutorial,
LepR3-PCR.gen. as well as pBI121.gen. Save these files in your as4 directory.

To make it easier to write your report, you can download template files in LibreOffice or MS-Word format. These documents contain dummy data to be replaced with your own data.

References
Restriction enzymes: New England Biolabs REBASE
LibreOffice Draw: Video tutorials from TheFrugalComputerGuy.com
LibreOffice Draw: How to crop an image

Overview: What we want to do is to create a construct in which the LepR3 PCR product is cloned into pBI121, replacing the 35S-GUS cassette. The 35S-GUS cassette is flanked by EcoRI and HindIII, so we can use those enzymes to cut the vector. One problem is that the LepR3 gene has internal sites for both EcoRI and HindIII, and would therefore be cut into several fragments. However, if we can find two enzymes, X and Y, that do NOT cut LepR3, we can build sites for X and Y into the PCR primers used to amplify the product, and cut the final product with X and Y. Next, we ligate onto the product two sets of synthetic adaptors, one with EcoRI and X, and the other with Y and HindIII sites. By ligating these adaptors onto the X/Y digested PCR product, the insert can now be cloned into the EcoRI/HindIII cut pBI121.

A simple map of the final construct is shown below.

Figure 1.

UPPERCASE - nucleotides from pBI121 or from the PCR primers
lowercase - nucleotides from the adaptors
NNNN - nucleotides from original primers
XXXXXX, YYYYYY - recognition sequences for enzymes X and Y
nnnnnn - arbitrarily chosen nucleotides for primers or adaptors
Restriction cuts generating sticky ends are shown as red lines.

1. Use BACHREST to generate a list of restriction enzymes that do NOT cut within the 5.2 kb PCR fragment for LepR3

Read LepR3-PCR.gen into bldna, and use BACHREST to create a list of enzymes that do not cut this fragment. Since this PCR product is linear, if an enzyme fails to cut it, we are still left with one fragment.

To narrow the list further, the best enzymes for cloning will

not generate blunt ends
have a 4 base overhang
not have ambiguous nucleotides (eg. only A, G, C or T, and not N, R,Y etc.)
cut symmetrically. An example of an asymmetric cutter would be BseYI, CCCAGC(-5/-1)
To ensure directional cloning, the two enzymes you choose should have different sticky ends. For example, BamHI and Sau3AI both give a 5'GATC3' overhang.

To limit the search based on these criteria, set "Max. number of fragments generated" to 1, "Include enzymes generating blunt ends? to No, and Include Symmetric sites only.

Save this file as LepR3-PCR-nosites.bachrest.

In your report:

Choose two restriction enzymes as enzymes X and Y, and list the name, recognition sequences and cutting sites for each of these enzymes.

2. (3 points) Modify your PCR primers to include unique restriction sites and at the 5' ends of both primers

The original primers chosen in the In-silico PCR by PrimerBLAST tutorial were:

Forward: 5'CGTGCTCTCAGTTGCCAAGA3'
Reverse: 5'GCACAGCACCACAGCCTTTA3'

To add restriction sites to these primers we need to do two things. First, we add the recognition sequences, X or Y, to each primer. However, restriction enzymes can't cut sites at the extreme 5' ends of linear fragments. Therefore, we need to add at least 6 nt of "padding" to the 5' ends, to give the enzyme a short DNA duplex to grab onto on the linear fragment. To ensure a stable duplex, it is best that the padding sequence is GC rich. Your final primers should look something like this:

Forward: 5'nnnnnnXXXXXXCGTGCTCTCAGTTGCCAAGA3'
Reverse: 5'nnnnnnYYYYYYGCACAGCACCACAGCCTTTA3'

(n,X,Y - as described in Figure 1.)

In your report:

List sequences for your modified forward and reverse primers

3. (3 points) Design left and right adaptors

After amplification of the LepR3 gene using the modified primers from part 2, the next steps in the cloning process will be to cut the PCR product with enzymes X or Y, followed by ligation of adaptors bearing either EcoRI or HindIII sticky ends onto the X and Y sticky ends.

Cloning adaptors are pairs of oligonucleotides which, when base-paired, have an internal double-stranded region, and sticky ends for restriction sites at each end. Your job is to design two pairs of oligonucleoides for use as adaptors. One pair will have sticky ends for EcoRI and X, the other pair will have sticky ends for HindIII and Y.

The following example illustrates what an adaptor might look like, which would, in effect, add a BamHI (5'G^GATCC3') site to a Sal I (5'G^TCGAC3') site:

A. Oligonucleotides

BS1: 5'GATCCGGGCCCG3'
BS2: 5'TCGACGGGCCCG3'

B. How the oligonucleotides would pair in-vitro

5'GATCCGGGCCCG3'
3' GCCCGGGCAGCT5'

The idea is that if these adaptors are used to connect a Bam HI fragment with a SalI fragment, the BamHI and SalI sites would be reconstituted, so that these sites could be cut in later cloning steps if need be. Arbitrary nucleotides, indicated by the line between the oligos in panel B, can be any sequence, although GC rich sequences help to ensure that oligos will form a stable duplex. (Incidentally, the sequence GGGCCC is recognized by a number of restriction enzymes eg. ApaI.)

Additional criterion: design different internal duplex sequences for each pair of oligos, such that oligonucleotides from one pair will NOT form duplexes with oligos from the other pair.

In your report:

Create a table similar to the one above for each of the two oligonucleotide pairs

4. (3 points) Plan your construct

You now have all the information necessary to predict the sequence of the cloning junctions between pBI121, your cloning adaptors, and the restriction-cut PCR fragment.

In your report:

Create a diagram similar to that in Figure 1, in which the ambiguous bases n,N,X and Y are replaced by the actual sequences from the primers and adaptors you designed in parts 2 and 3.

For your convenience, the original LibreOffice document for Figure 1 is available in the file construct_template.odg. If you wish to use this document save it as pLepR3-BI121.odg, and work on that copy. Export your final diagram as a PNG image file, pLepR3-BI121.png, using the following steps:

Edit --> Select all
File --> Export. Set the name to pLepR3-BI121.png
Set the format to PNG
Check the "Selection" box to save only the selection. (Failure to check this box will create a much larger image file with most of the page as blank space.)
In the PNG options menu, make sure that the box entitled "Save transparancy" is NOT checked.
Import this image file into section 4 of your report.

If you don't wish to use LibreOffice Draw, you may use a different program to illustrate the construct. For this part, the only critical thing is to somehow represent, in your report, the complete sequences of the EcoRI/X and Y/HindIII primer junction regions, including the actual primer sequences as they will appear in the final plasmid construct.

Creating your construct in silico

In the remaining steps, you will use UGENE to create your construct. One complicating factor is that programs that work with DNA sequences almost universally represent only a single strand, where the complementary strand is implied. For cloning steps, the representation of sticky ends is a special case. We will also end up typing in each adapter pair as if it was a single strand of a double-stranded duplex. These steps will be described in more detail as we proceed.

To keep all of your files organized, start UGENE and create a new project called as4.

5. Digest pBI121 with EcoRI and HindIII

Open pBI121.gen in UGENE, and do the following.

Run Analyze --> Find restriction sites, and search for the EcoRI and HindIII sites.
Run Cloning --> Digest into fragments and cut with EcoRI and HindIII.

You will use these fragments when we assemble the construct.

In your report:

Show a map of pBI121 after digestion with EcoRI and HindIII, and make sure those sites appear on the map. Fragment 1 and Fragment 2 should also appear.

Now is a good time to save your project. It is recommended that you save your project at the end of each of parts 5 - 8.

6. (3 points) In UGENE, create the X/Y restriction fragment for the PCR product.

a) Add the X restriction site and padding nucleotides to the left end of the LepR3 PCR fragment.

Using the diagram from part 4 as a guide, add the sequence for the restriction sites and "padding", consistent with part 2. This should create the exact sequence of the PCR product, if amplified from genomic DNA using the modified primers from part 2.

In UGENE, you can add nucleotides to either end using Actions --> Edit sequence --> Insert subsequence.

Choose "Position to insert", either the start or end
Type in or paste the sequence you wish to add in the "Paste data here" box.
Check the "Recalculate values of qualifiers" box. (Required to preserve annotation in the output file.)
Choose "Save to new file" and "Merge annotations to this file". Set document format to GenBank, and save the file as LepR3_modprimer.gb.
Read the new file into UGENE, which will open as a new tab.
To eliminate confusion, it is a good idea at this point to close the tab containing the original LepR3 sequence.

As a check that this step has been done correctly, you should see the sequences you added in the Details window.

b) Add the Y restriction site and padding nucleotides to the right end of the modified LepR3 PCR fragment.

This is the same as step a), but with the following differences:

Obviously, you need to make sure you are adding the sequence in the correct strand and orientation

Set the position to insert to the end of the sequence

Save to the same file, LepR3_modprimer.gb ie. just overwrite the file you created.

Again, check in the Details panel to make sure that you have added the correct sequences, before proceeding to the next step.

c) Create your X and Y digested fragments.

Run Analyze --> Find restriction sites, and search for the X and Y sites.
Run Cloning --> Digest into fragments and cut with X and Y.

In the Annotation Editor, you should be able to verify the presence of 3 restriction fragments, one very long fragment with your digested PCR product, and two very small fragments representing the ends that were cut off by the enzymes.

In your report:

Create two screenshots from the Details window, one showing the left end of the sequence, including the forward primer with its modifications, and the other showing the right end of the sequence, including the reverse primer and its modifications. See the template document for an idea of what these screenshots should look like. Screenshots should be cropped, as shown in the template. See LibreOffice Draw: How to crop an image.

7. (2 points) Create your two adaptor sequences

This step will require you to create a single stranded sequence, representing a double-stranded duplex such that, if it were cut with the two desired enzymes, the duplex would give the adaptor pair with the correct overhang ends. The best way is to create a single strand in the form AAAAAABBBBBBCCCCCC, where

AAAAAA - the first restriction site
BBBBBB - the core sequence of the adaptor
CCCCCC - the second restriction site

Note that these sites are the complete recognition sequences for each enzyme.

Taking as an example the BamHI/SalI adaptor pair in part 3, the sequence to be pasted into UGENE would be

5'GGATCCGGGCCCGTCGAC3'

Since the other strand is implied, UGENE will work with this sequence as if it was

5'GGATCCGGGCCCGTCGAC3'
3'CCTAGGGCCCGGGCAGCTG5'

When UGENE digests this sequence, one of the fragments will be the adaptor pair shown in part 3, box B.

Hint: If you have correctly designed the sequences in pLepR3-BI121.odg or equivalent document, you should be able to do the two sequence pasting steps below by copying sequence directly from this document and pasting into the "Paste data here" box.

a) Create the left adaptor

File --> New document from text
Paste your sequence into the "Paste data here" box.
Set the document location to your as4 directory
Document format: FASTA
Sequence name: Left_adaptor
Check "Save file immediately"

The adaptor will automatically appear in a new tab.

b) Create your EcoRI/X fragments.

If the restriction sites are not already shown, run Analyze --> Find restriction sites, and search for the EcoRI and X sites.
Run Cloning --> Digest into fragments and cut with EcoRI and X.

Again, the Edit annotations panel should show you a large fragment (Fragment 2) with sticky ends for EcoRI and X.

c & d) Create the right adaptor and Y/HindIII fragments using the same procedure as in a) and b).

In your report:

Create two screenshots showing the Overview window. One screenshot should show the Left adaptor, the other should show the Right adaptor. Screenshots should be cropped, as shown in the template. See LibreOffice Draw: How to crop an image.

8. (4 points) Assemble the completed construct

You should now have all the fragments necessary to assemble the complete construct.

Choose Cloning --> Construct molecule.

In the Construction tab, add fragments in the correct order, using your plan from part 4 as a guide. If two adjacent fragments can ligate together, their sticky ends will be shown in green in the "New molecule contents" panel. When sticky ends between two adjacent fragments are incompatible, they will be shown in red. If you wish to reverse the orientation of a fragment to make the ends compatible, click on the box in the "Inverted" column.

Make sure to check the box saying "Annotate fragments in the new molecule", and the "Make circular" box.

All sticky ends must be green to get a circular molecule. If some of your sticky ends are red or black, a previous step may need to be revised.

In the Output tab, call the output file pLepR3-BI121.gb, and check the "Save immediately" box. Click OK to save.

Your complete plasmid construct, with LepR3-BI121 should appear in a new tab with annotation preserved.

Next, search for EcoRI, HindIII, X and Y, so that these can be placed on the map. (You may need to rotate the map using the mouse wheel to get all four of these sites to appear on the map.)

Note: There should be 7 HindIII sites in the final construct. However, make sure when searching for restriction sites to set "Maximum hits" to 7 or greater, or Ugene won't display the sites.

In your report:

Include a circular map of your completed construct in part 8, as shown in the Overview panel.

9. (2 points) Presentation of the report

The report should include the following:

All data requested for parts 1 - 8.

In addition to your report, also upload to the UMLearn Dropbox any new GenBank, FASTA or BACHREST files created for this assignment. Don't bother uploading the png image files. These should be embedded in your report.

Presentation guidelines

Screenshots should show the data requested, and be readable.

Screenshots should only show the relevant window(s), not the entire screen.
Screenshots for this project are wide. To keep text from wrapping around images, select each image and choose Format --> Wrap --> No wrap.
Use fixed fonts for all sequences in parts 1 - 4 (eg. primers, adaptors), as described in Assignment 3.

When saving files in Linux, it is usually best NOT to include blank spaces in file names.

Submitting your assignment

Your PDF report, along with associated GenBank, FASTA and BACHREST files, is due by 11:59 pm, Monday April 8 on the PLNT2530 UMLearn dropbox site in the Assignment 4 folder. Files in word processing formats (.doc, .docx, .rtf, .odt) are not acceptable.

If you have questions, it may help to send me a message at frist@cc.umanitoba.ca.