|
|
showorf |
Please help by correcting and extending the Wiki pages.
showorf writes an input nucleotide sequence and its protein translation to an output file in a clear format that is suitable for publication. The translation can be done in any frame or combination of frames using an (optionally) specified genetic code.
% showorf
Display a nucleotide sequence and translation in pretty format
Input nucleotide sequence: tembl:x13776
Select Frames To Translate
0 : None
1 : F1
2 : F2
3 : F3
4 : R1
5 : R2
6 : R3
Select one or more values [1,2,3,4,5,6]:
Output file [x13776.showorf]:
|
Go to the input files for this example
Go to the output files for this example
Display a nucleotide sequence and translation in pretty format
Version: EMBOSS:6.4.0.0
Standard (Mandatory) qualifiers:
[-sequence] sequence Nucleotide sequence filename and optional
format, or reference (input USA)
-frames menu [1,2,3,4,5,6] Select one or more values
(Values: 0 (None); 1 (F1); 2 (F2); 3 (F3); 4
(R1); 5 (R2); 6 (R3))
[-outfile] outfile [*.showorf] Output file name
Additional (Optional) qualifiers:
-table menu [0] Genetic code to use (Values: 0
(Standard); 1 (Standard (with alternative
initiation codons)); 2 (Vertebrate
Mitochondrial); 3 (Yeast Mitochondrial); 4
(Mold, Protozoan, Coelenterate Mitochondrial
and Mycoplasma/Spiroplasma); 5
(Invertebrate Mitochondrial); 6 (Ciliate
Macronuclear and Dasycladacean); 9
(Echinoderm Mitochondrial); 10 (Euplotid
Nuclear); 11 (Bacterial); 12 (Alternative
Yeast Nuclear); 13 (Ascidian Mitochondrial);
14 (Flatworm Mitochondrial); 15
(Blepharisma Macronuclear); 16
(Chlorophycean Mitochondrial); 21 (Trematode
Mitochondrial); 22 (Scenedesmus obliquus);
23 (Thraustochytrium Mitochondrial))
-[no]ruler boolean [Y] Add a ruler
-[no]plabel boolean [Y] Number translations
-[no]nlabel boolean [Y] Number DNA sequence
Advanced (Unprompted) qualifiers:
-width integer [50] Width of screen (Integer 10 or more)
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of the sequence to be used
-send1 integer End of the sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outfile" associated qualifiers
-odirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options and exit. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
-version boolean Report version number and exit
|
| Qualifier | Type | Description | Allowed values | Default | ||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||||||||||||||||||||||||||||||||||||||
| [-sequence] (Parameter 1) |
sequence | Nucleotide sequence filename and optional format, or reference (input USA) | Readable sequence | Required | ||||||||||||||||||||||||||||||||||||
| -frames | list | Select one or more values |
|
1,2,3,4,5,6 | ||||||||||||||||||||||||||||||||||||
| [-outfile] (Parameter 2) |
outfile | Output file name | Output file | <*>.showorf | ||||||||||||||||||||||||||||||||||||
| Additional (Optional) qualifiers | ||||||||||||||||||||||||||||||||||||||||
| -table | list | Genetic code to use |
|
0 | ||||||||||||||||||||||||||||||||||||
| -[no]ruler | boolean | Add a ruler | Boolean value Yes/No | Yes | ||||||||||||||||||||||||||||||||||||
| -[no]plabel | boolean | Number translations | Boolean value Yes/No | Yes | ||||||||||||||||||||||||||||||||||||
| -[no]nlabel | boolean | Number DNA sequence | Boolean value Yes/No | Yes | ||||||||||||||||||||||||||||||||||||
| Advanced (Unprompted) qualifiers | ||||||||||||||||||||||||||||||||||||||||
| -width | integer | Width of screen | Integer 10 or more | 50 | ||||||||||||||||||||||||||||||||||||
| Associated qualifiers | ||||||||||||||||||||||||||||||||||||||||
| "-sequence" associated sequence qualifiers | ||||||||||||||||||||||||||||||||||||||||
| -sbegin1 -sbegin_sequence |
integer | Start of the sequence to be used | Any integer value | 0 | ||||||||||||||||||||||||||||||||||||
| -send1 -send_sequence |
integer | End of the sequence to be used | Any integer value | 0 | ||||||||||||||||||||||||||||||||||||
| -sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N | ||||||||||||||||||||||||||||||||||||
| -sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N | ||||||||||||||||||||||||||||||||||||
| -snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N | ||||||||||||||||||||||||||||||||||||
| -sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N | ||||||||||||||||||||||||||||||||||||
| -slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N | ||||||||||||||||||||||||||||||||||||
| -supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N | ||||||||||||||||||||||||||||||||||||
| -sformat1 -sformat_sequence |
string | Input sequence format | Any string | |||||||||||||||||||||||||||||||||||||
| -sdbname1 -sdbname_sequence |
string | Database name | Any string | |||||||||||||||||||||||||||||||||||||
| -sid1 -sid_sequence |
string | Entryname | Any string | |||||||||||||||||||||||||||||||||||||
| -ufo1 -ufo_sequence |
string | UFO features | Any string | |||||||||||||||||||||||||||||||||||||
| -fformat1 -fformat_sequence |
string | Features format | Any string | |||||||||||||||||||||||||||||||||||||
| -fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |||||||||||||||||||||||||||||||||||||
| "-outfile" associated outfile qualifiers | ||||||||||||||||||||||||||||||||||||||||
| -odirectory2 -odirectory_outfile |
string | Output directory | Any string | |||||||||||||||||||||||||||||||||||||
| General qualifiers | ||||||||||||||||||||||||||||||||||||||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N | ||||||||||||||||||||||||||||||||||||
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N | ||||||||||||||||||||||||||||||||||||
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N | ||||||||||||||||||||||||||||||||||||
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N | ||||||||||||||||||||||||||||||||||||
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N | ||||||||||||||||||||||||||||||||||||
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y | ||||||||||||||||||||||||||||||||||||
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N | ||||||||||||||||||||||||||||||||||||
| -warning | boolean | Report warnings | Boolean value Yes/No | Y | ||||||||||||||||||||||||||||||||||||
| -error | boolean | Report errors | Boolean value Yes/No | Y | ||||||||||||||||||||||||||||||||||||
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y | ||||||||||||||||||||||||||||||||||||
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y | ||||||||||||||||||||||||||||||||||||
| -version | boolean | Report version number and exit | Boolean value Yes/No | N | ||||||||||||||||||||||||||||||||||||
The input is a standard EMBOSS sequence query (also known as a 'USA').
Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl
Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.
The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug.
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.
ID X13776; SV 1; linear; genomic DNA; STD; PRO; 2167 BP.
XX
AC X13776; M43175;
XX
DT 19-APR-1989 (Rel. 19, Created)
DT 14-NOV-2006 (Rel. 89, Last updated, Version 24)
XX
DE Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation
XX
KW aliphatic amidase regulator; amiC gene; amiR gene.
XX
OS Pseudomonas aeruginosa
OC Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales;
OC Pseudomonadaceae; Pseudomonas.
XX
RN [1]
RP 1167-2167
RA Rice P.M.;
RT ;
RL Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases.
RL Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
RN [2]
RP 1167-2167
RX DOI; 10.1016/0014-5793(89)80249-2.
RX PUBMED; 2495988.
RA Lowe N., Rice P.M., Drew R.E.;
RT "Nucleotide sequence of the aliphatic amidase regulator gene (amiR) of
RT Pseudomonas aeruginosa";
RL FEBS Lett. 246(1-2):39-43(1989).
XX
RN [3]
RP 1-1292
RX PUBMED; 1907262.
RA Wilson S., Drew R.;
RT "Cloning and DNA sequence of amiC, a new gene regulating expression of the
RT Pseudomonas aeruginosa aliphatic amidase, and purification of the amiC
RT product";
RL J. Bacteriol. 173(16):4914-4921(1991).
XX
RN [4]
RP 1-2167
RA Rice P.M.;
RT ;
RL Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases.
RL Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
DR GOA; Q51417.
DR InterPro; IPR003211; AmiSUreI_transpt.
DR UniProtKB/Swiss-Prot; Q51417; AMIS_PSEAE.
[Part of this file has been deleted for brevity]
FT /replace=""
FT /note="ClaI fragment deleted in pSW36, constitutive
FT phenotype"
FT misc_feature 1
FT /note="last base of an XhoI site"
FT misc_feature 648..653
FT /note="end of 658bp XhoI fragment, deletion in pSW3 causes
FT constitutive expression of amiE"
FT conflict 1281
FT /replace="g"
FT /citation=[3]
XX
SQ Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other;
ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat 60
ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac 120
aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg 180
aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg 240
agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc 300
ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg 360
tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg 420
agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga 480
acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga 540
ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa 600
gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct 660
acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg 720
cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg 780
ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg 840
aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt 900
acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct 960
tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc 1020
tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt 1080
acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca 1140
gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc 1200
agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt 1260
ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg 1320
cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca 1380
gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt 1440
gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc 1500
gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc 1560
cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga 1620
tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa 1680
gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca 1740
ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct 1800
gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg 1860
aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt 1920
catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg 1980
gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct 2040
gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa 2100
ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt 2160
cctcgag 2167
//
|
The true ORFs are 1..109 (amiB partial) 135..1292 (amiC) 1289..1879 (amiR) 1925..end (amiS partial)
SHOWORF of X13776 from 1 to 2167
---------|---------|---------|---------|---------|
1 ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacggga 50
F1 1 G T A G R A S A R S P P A G R R E 17
F2 1 V P L A E H L L D H H Q P G D G N 17
F3 1 Y R W P S I C S I T T S R A T G 16
R1 9 T G S A S C R S S * W W G P S P 5
R2 106 Y R Q G L M Q E I V V L R A V P 91
R3 38 V A P R A D A R D G G A P R R S 23
---------|---------|---------|---------|---------|
51 actgcacgatctacctggcgagcctggagcacgagcgggttcgcttcgta 100
F1 18 L H D L P G E P G A R A G S L R T 34
F2 18 C T I Y L A S L E H E R V R F V 33
F3 17 T A R S T W R A W S T S G F A S Y 33
R1 4 F Q V I * R A L R S C S R T R K T 31
R2 90 V A R D V Q R A Q L V L P N A E Y 74
R3 22 S C S R G P S G P A R A P E S R 7
---------|---------|---------|---------|---------|
101 cggcgctgagcgacagtcacaggagaggaaacggatgggatcgcaccagg 150
F1 35 A L S D S H R R G N G W D R T R 50
F2 34 R R * A T V T G E E T D G I A P G 14
F3 34 G A E R Q S Q E R K R M G S H Q E 50
R1 30 R R Q A V T V P S S V S P I A G P 14
R2 73 P A S R C D C S L F R I P D C W 58
R3 6 V A S L S L * L L P F P H S R V L 398
---------|---------|---------|---------|---------|
151 agcggccgctgatcggcctgctgttctccgaaaccggcgtcaccgccgat 200
F1 51 S G R * S A C C S P K P A S P P I 13
F2 15 A A A D R P A V L R N R R H R R Y 31
F3 51 R P L I G L L F S E T G V T A D 66
R1 13 A A A S R G A T R R F R R * R R 49
R2 57 S R G S I P R S N E S V P T V A S 41
R3 397 L P R Q D A Q Q E G F G A D G G I 381
---------|---------|---------|---------|---------|
201 atcgagcgctcgcacgcgtatggcgcattgctcgcggtcgagcaactgaa 250
F1 14 S S A R T R M A H C S R S S N * T 1
F2 32 R A L A R V W R I A R G R A T E 47
F3 67 I E R S H A Y G A L L A V E Q L N 83
R1 48 Y R A S A R T H R M A R P R A V S 32
R2 40 I S R E C A Y P A N S A T S C S F 24
R3 380 D L A R V R I A C Q E R D L L Q 365
---------|---------|---------|---------|---------|
251 ccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggacc 300
F1 2 A R A A S A V A R S K R C P R T 17
[Part of this file has been deleted for brevity]
F2 8 N N K R G I V I M L G L V L L Y V 24
F3 22 I T R G V S S S C W D W F C C T L 38
R1 53 L L L L P I T M M S P S T R S Y T 37
R2 73 I V L P T D D D H Q S Q N Q Q V 58
R3 7 C Y C S P Y R * * A P V P E A T R 7
---------|---------|---------|---------|---------|
1951 tggcgcggtgctgtttctcaatgccgtctggttgctgggcaagatcagcg 2000
F1 16 W R G A V S Q C R L V A G Q D Q R 32
F2 25 G A V L F L N A V W L L G K I S G 41
F3 39 A R C C F S M P S G C W A R S A 54
R1 36 P A T S N R L A T Q N S P L I L 21
R2 57 N A R H Q K E I G D P Q Q A L D A 41
R3 6 Q R P A T E * H R R T A P C S * R 7
---------|---------|---------|---------|---------|
2001 gtcgggaggtggcggtgatcaacttcctggtcggcgtgctgagcgcctgc 2050
F1 33 S G G G G D Q L P G R R A E R L R 49
F2 42 R E V A V I N F L V G V L S A C 57
F3 55 V G R W R * S T S W S A C * A P A 3
R1 20 P R S T A T I L K R T P T S L A Q 4
R2 40 T P L H R H D V E Q D A H Q A G A 24
R3 6 D P P P P S * S G P R R A S R R 28
---------|---------|---------|---------|---------|
2051 gtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaa 2100
F1 50 R V L P D L F R S S R A G L A E 65
F2 58 V A F Y L I F S A A A G Q G S L K 74
F3 4 S R S T * S F P Q Q P G R A R * R 1
R1 3 T A N * R I K E A A A P C P E S F 12
R2 23 D R E V Q D K G C C G P L A R Q 8
R3 27 R R T R G S R K R L L R A P S A S 11
---------|---------|---------|---------|---------|
2101 ggccggagcgctgaccctgctattcgcttttacctatctgtgggtggccg 2150
F1 66 G R S A D P A I R F Y L S V G G R 82
F2 75 A G A L T L L F A F T Y L W V A A 91
F3 2 P E R * P C Y S L L P I C G W P 12
R1 11 A P A S V R S N A K V * R H T A 7
R2 7 L G S R Q G Q * E S K G I Q P H G 7
R3 10 P R L A S G A I R K * R D T P P R 6
---------|-------
2151 ccaaccagttcctcgag 2167
F1 83 Q P V P R 87
F2 92 N Q F L E 96
F3 13 P T S S S 17
R1 6 A L W N R S 1
R2 6 G V L E E L 1
R3 5 W G T G R 1
|
| Program name | Description |
|---|---|
| backtranambig | Back-translate a protein sequence to ambiguous nucleotide sequence |
| backtranseq | Back-translate a protein sequence to a nucleotide sequence |
| checktrans | Reports STOP codons and ORF statistics of a protein |
| coderet | Extract CDS, mRNA and translations from feature tables |
| getorf | Finds and extracts open reading frames (ORFs) |
| marscan | Finds matrix/scaffold recognition (MRS) signatures in DNA sequences |
| plotorf | Plot potential open reading frames in a nucleotide sequence |
| prettyseq | Write a nucleotide sequence and its translation to file |
| remap | Display restriction enzyme binding sites in a nucleotide sequence |
| showseq | Displays sequences with features in pretty format |
| sixpack | Display a DNA sequence with 6-frame translation and ORFs |
| syco | Draw synonymous codon usage statistic plot for a nucleotide sequence |
| tcode | Identify protein-coding regions using Fickett TESTCODE statistic |
| transeq | Translate nucleic acid sequences |
| wobble | Plot third base position variability in a nucleotide sequence |
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.