PLNT 3140 Introductory Cytogenetics- 2023

Kinetic Classes of Genomic DNA

Up to this point, we have been studying eukaryotic genomes from a very structural and mechanistic perspective. We have largely ignored the whole purpose for its existence, that being the storage and expression, and replication of genetic information. For the next four readings, we will focus on the information contained in the genome, and its organization within the chromosomes.

DNA denatures, or melts, according to bonding strength between strands

Purine and pyrimidine bases have a peak absorbance at 260 nm. For ssDNA, the absorbance of the DNA molecule is about the same as would be predicted by adding up the absorbances of each individual nucleotide. In duplexed DNA, the total A260 is less than the sum of the absorbances of the constituent nucleotides, due to electronic interactions between the stacked bases. This is referred to as the hypochromic effect. As the DNA melts (or denatures), the amount of single-stranded DNA increases, relative to the amount of double-stranded DNA. Consequently, the absorbance also increases.

eg. polyA:polyT AAAAAAAAAA
                TTTTTTTTTT

 heterogeneous  GGTACTACCAT
                CCATGATGGTA

 polyG:polyC    GGGGGGGGGGG
                CCCCCCCCCCC

When melting DNA in experimental conditions, a quantity called T_M is observed. T_M is the temperature at which half of the DNA is denatured, or has become single-stranded. Since T_M is directly related to base composition, it can be used to estimate the composition of an unknown DNA sequence.

The time taken for DNA strands to reassociate increases as a function of genome complexity

Just as DNA melting can tell us something about the sequences present, so can reassociation.

Protocol:

1. Shear DNA to ca. 400bp (eg. blender,sonicator, passage through a small orifice).
2. Denature fragments by boiling.
3. Reassociate in 0.18M salt
4. Measure A₂₆₀ or, if radioactively labeled, amount bound to HAP (hydroxyapatite) column. HAP preferentially binds dsDNA at 0.18M salt

Under these conditions, the reassociation of DNA molecules in solution is described by the equation:

Where:

• C is the concentration of ssDNA in mol/L
• dC is change in concentration of ssDNA with respect to time
• t is time in seconds
• k is a second order rate constant (L mole^-1 sec^-1)
  

The equation can be rearranged to a more convenient form by defining dC as C/C₀:

C₀ ::= the initial[ssDNA] at time 0.
C₀t_½ ::= the value of C₀t at which annealing has proceeded to half completion (C/C₀=0.5).

Redrawn from Russel, P.J. (1986) Genetics Figure 7.24. Ideal time course for the renaturation of DNA as seen in a Cot (initial DNA concentration x time) plot. In the initial state the DNA is single-stranded, and in the final state it is all double-stranded. Note that 80 percent of the renaturation occurs over a 2 log Cot interval.

Complexity

Complexity (X) is defined as the longest non-repetitive sequence that can be derived from a sequence.

 The complexity (X) of a population of uniformly sized DNA molecules can be measured with the following equation:

X=KC₀t_½

where K has been determined under standard conditions (0.18M cations [eg. Na+], 400 nucleotide fragment size) as approximately 5 x 10⁵ L bp mole^-1 sec^-1. Rearranging the equation, we see that:

C₀t_½=X/K

Therefore, C0t½ increases with the complexity of the DNA. We can use this relation to measure genome size as shown in the figure at right.

In the figure above, all the graph lines take roughly the same shape. Something different happens when we compare prokaryotes (like E. coli) and eukaryotes:

Redrawn from  Russel,P.J. (1986 )Genetics Fig. 7-25b. Kinetics of renaturation of DNAfrom calf thymus and E. coli as seen in a Cot plot. The E.coli DNA consists almost entirely of unique sequences. However, the shape of the Cot curve for the calf DNA is very different from that of E. coli and indicates that there are some sequences (toward the right of the curve) that renature much more slowly and some (toward the left of the curve) that renature much more quickly than the bacterial DNA sequences.

The E. coli DNA consists almost entirely of unique sequences. However, the shape of the C₀t curve for the calf DNA is very different from that of E. coli and indicates that there are some sequences (toward the right of the curve) that renature much more slowly and some (toward the left of the curve) that renature much more quickly than the bacterial DNA sequences. The C₀t curves for Calf thymus and E. coli DNA indicate that, while E. coli DNA anneals at a relatively sharp inflection point, Calf DNA contains three major kinetic classes:

• highly repetitive, which reanneals very early in the reaction,
• middle repetitive, which anneals over more than 3 log C₀t, and
• single copy, which anneals at very high C₀t values

The term "single-copy" is a bit misleading, in that it refers to 1 - 10 copies per haploid genome. In fact, any distinction between single copy and middle repetitive forces you to draw an arbitrary line. They are useful concepts because they bring out something of the content of genomes, but the definitions of highly repetitive, middle repetitive and single-copy shouldn't be pushed too far. Another point to mention is that although most protein coding genes are found in the single copy fraction, not all of the single copy fraction is protein coding genes. There appears to be a lot of non-coding single copy "junk" in many eukaryotic genomes

Complexity of a Single Class

C₀t_½(pure) = f C₀t_½(mixed)

Where pure indicates a purified fraction and mixed indicates whole genomic DNA. This value can be plugged into the equation for complexity:

X = KC₀t_½(pure)

By combining data for the different kinetic classes, the complexity and size for a wide range of genomes has been measured, as shown in the following table:

Each kinetic class of genomic DNA contains distinct types of sequences

We've briefly introduced the three kinetic classes of genomic DNA: "single" copy (1 - 10), middle repetitive, and highly repetitive. Now it's time to investigate which kinds of DNA fall into those categories. Remember, we measure the complexity of DNA based on how long it takes to reanneal. To classify (as much as we can) different parts of DNA, the basic idea is to first perform a reassociation experiment, then calculate the C₀t value for that part of DNA. Then we can sort portions of DNA based on those values.

Single Copy Fraction - mRNA

It is possible to determine the distribution of mRNA sequences in the kinetic classes of DNA by hybridizing labeled polyA+ RNA with an excess of unlabeled DNA. The C₀t value at which a given fraction of RNA hybridizes with unlabeled DNA indicates the kinetic fraction into which that RNA falls. Most genes coding for mRNAs fall into the single copy class (~1-10 copies/haploid genome).

Note: The exact definition of "single-copy" DNA varies from author to author.

This labeling experiment takes place in a HAP column as follows: Hydroxyapatite (HAP) = crystalline Ca10(PO4)6(OH)2 1) Bind DNA & probe to HAP at low salt. 2) Elute with increasing quantites of salt. ssDNA, unhybridized probe elutes first. At high salt, the duplexed material elutes. This method could also be used to isolate DNA from specific kinetic classes. It also tells you the fraction of probe that is in double-stranded or single-stranded: amt. of radioactivity that elutes at high salt fraction dsDNA = ------------------------------------------------ total amount of radioactivity

Hybridization of labeled RNA to genomic DNA

When you add trace quantities of radioactively-labeled RNA to an excess of ssDNA, most of the radioactive probe anneals to DNA (becomes ds) at high C0t values. This indicates that most of the RNA was transcribed from single copy DNA. That is, most genes are present in single copy DNA.

Middle Repetitive Fraction - Other RNAs and SINEs

This is a very heterogeneous class of sequences, ranging from 10¹ to 10 ⁵ repeats per haploid genome. Some examples of DNA that fall into this category are:

• tRNA (250 - 1300 copies)
• 5S rRNA (140 - 24,000 copies)
• pre-rRNA genes (140 - 450 copies)
• Other transcribed sequences for proteins (eg. histones)

Note: rRNAs for eukaryotic 18S, 5.8s and 26S rRNAs are transcribed as a single transcript and cleaved into the mature rRNAs. The rRNA genes are present as tandemly-repeated units at the nucleolar organizer regions (NOR). One or more NOR's may be located of different chromosomes.

SINES - short interspersed repeats

One of the families of repeated sequences that falls into this class is called SINEs, which stands for short interspersed elements. One of the most prominent SINE families in primates is called the Alu1 family. The Alu1 family in primates is a 300 bp retrotransposon (we'll talk more about transposons later on). These sequences have been shown to be transcribed into RNA, reverse transcribed into DNA, and inserted randomly into thousands of locations throughout the genome. Alu1 family sequences were discovered by annealing genomic DNA to low C0t and then treating the DNA with the single-stranded nuclease S1. S1 degrades single-stranded DNA, leaving double stranded DNA intact. When loaded on a gel, the dsDNA exhibited a 300 bp band, against a background of thousands of other bands. When the DNA products were digested with the restriction enzyme Alu1, most of the 300 bp band was shifted to two bands of 170 and 130 bp. This indicates that most of the copies of the 300 bp sequence contain an internal Alu1 site. Hence the name, "Alu1 family".

FISH of human chromosomes using an AluI family probe (green), and counterstained with the DNA-specific dye TOPRO3 (red). These data indicate that members of the AluI family can be found on all human chromosomes, dispersed among thousands of chromosomal locations. From: Three-Dimensional Maps of All Chromosomes in Human Male Fibroblast Nuclei and Prometaphase Rosettes Bolzer A, Kreth G, Solovei I, Koehler D, Saracoglu K, et al. PLoS Biology Vol. 3, No. 5, e157 (2005) doi:10.1371/journal.pbio.0030157

Middle repetitive sequences are interspersed with genes along the chromosome.

A six million nucleotide region of chromosome 15 is shown in the NCBI Genome Data Viewer. Middle repetitive sequences are superimposed above maps for transcripts in which exons are thick red boxes and introns are thin red lines. We can see that repetitive sequences are found both in intergenic regions as well as within introns.

Highly Repetitive Fraction - Satellite DNA

This fraction consists largely of satellite DNA, and in particular the motifs that make up centromeric and telomeric DNA. These sequences are repeated more than 10⁵ times per haploid genome.

There are many families of satellite sequences in eukaryotic genomes. An example is the As51 class of satellite sequences found in several species of charachid fishes. Note that this family of sequences is seen on several chromosomes, both at centromeric and telomeric regions. 

from Abel LDdS, Mantovani M, Moreira-Filho O (2006) Chromosomal distribution of the As51 satellite DNA in two species complexes of the genus Astyanax (Pisces, Characidae) Genet. Mol. Biol. 29:448-452. doi: 10.1590/S1415-47572006000300008 Link As51 satellite (GB:U87962) 5'GGTCAAAAAGTCGAAAAAATGACTA- AGTCCCACTTGGTCTACCATTGGTAC3'

Further reading: Lewis, R. 2002. C₀t analysis stages a revival: a three-decade-old technique finds new life in the genomicists' tool chest. The Scientist 16 (16): 49 - 50.