PLNT 3140 Introductory Cytogenetics - 2024

Recombinant DNA I

DNA structure underlies chromosome structure

DNA consists of three main elements: nitrogenous bases, five-carbon sugars, and phosphates. The four common nitrogenous bases used in DNA are cytosine, thymine, guanine, and adenine. RNA exchanges the deoxyribose sugar for a ribose sugar, and the nitrogenous base thymine for uracil. A single nucleotide consists of all three elements, while a nucleoside has only the base and sugar components. An important characteristic of DNA is that the phosphates in the backbone have an excess of negative charge. Even though other parts of the molecule may have positive changes, the backbone makes DNA and RNA negatively charged overall.

from http://upload.wikimedia.org/wikipedia/commons/a/a2/AT_DNA_base_pair.png	from http://upload.wikimedia.org/wikipedia/commons/d/d3/GC_DNA_base_pair.png

DNA molecules can be represented different ways: with the phosphates, without, or simply as a line with 5' and 3' ends indicated:

5' AGTAGCTACGACTACGACTAGC 3'
             OR
5' pApGpTpApGpCpTpApCpGpApCpT 3'
             OR
5' -------------------------------------------------- 3'

A summary of gene structure

What is an intron?

An intron is the sequence spliced out of a pre-mRNA after transcription.

An intron is NOT:

• 5' or 3' UTRs
• non-coding DNA between genes
• synonymous with repetitive sequences (although repetitive sequences can be found within introns)

Restriction endonucleases cleave DNA at predictable sites within the strand

Nucleases are enzymes that cleave DNA. Endonucleases, then, are enzymes that cleave DNA within the strand, while exonucleases digest DNA from a free end. Restriction endonucleases, also sometimes called restriction enzymes, cleave only at specific sequences, and are used in cytogenetics to predictably cleave DNA in various experiments. A common restriction endonuclease is EcoRI, which is isolated from Escherichia coli.

Restriction enzymes come in many different types. EcoRI, with the other common restriction enzymes, are Type II. Type II restriction enzymes recognize and cleave DNA at the same site. That is, other types of restriction enzymes have their recognition sequences in one place but cut DNA at a different place. EcoRI recognizes the sequence 5'-GAATTC-3', and cuts between the G and the A. You might have noticed something interesting about that sequence - it's an inverted repeat. That is, it's the same 5' --> 3' on each strand. This means that EcoRI makes double-strand breaks, leaving uneven or sticky ends. linked from https://www.mun.ca/biology/scarr/Fg15_01.gif

Examples of some of the hundreds of commercially-available restriction enzymes

1isoschizomer - restriction endonucleases that recognize the same sequences
R = purine; Y = pyrimidine; N = {A,G,C or T}

Because genomes are very large, the cutting site for any given enzyme is likely to occur at a frequency proportional to the length of the recognition site. For example, EcoRI has a six base pair recognition sequence: GAATTC. This combination of nucleotides is likely going to occur every 4096 bases or so (4 nucleotides possible, 6 spots in recognition sequence: 4⁶=4096). Another restriction endonuclease, TaqI, has a recognition sequence of four base pairs: TCGA. This combination of nucleotides is likely to occur much more often, about every 256 nucleotides (4⁴=256). By using different restriction enzymes on genomic DNA, we can obtain fragments with different lengths distributions. 

A mononucleotide occurs every	4 1=	4 bases
dinucleotide	4 2=	16 bases
tri-	4 3=	64 bases	eg. codon
tetra-	4 4=	256 bases	eg. TaqI
penta-	4 5=	1024 bases	eg. MboII
hexa-	4 6=	4096 bases	eg. HindIII
hepta-	4 7=	16384 bases	eg. AbeI
octa-	4 8=	65536 bases	eg. NotI

Agarose gel electrophoresis separates DNA fragments on the basis of size

Gel electrophorsis is a powerful tool for assessing the types of DNA in a mixture. By visualizing individual bands of DNA on a gel, we can see the sizes of fragments, which gives us information on whether the experiment has worked so far, allows us to verify the identity of the DNA, and tells us whether or not the DNA is degraded.

Agarose gel electrophoresis separates DNA molecules based on size, by using a gel mesh and the application of charge. We previously reminded you that DNA has an overall negative charge, so it should make sense that DNA fragments would migrate towards positive charge. DNA is loaded into wells, then a current is applied.  The negatively charged DNA migrates toward the anode.

A typical agarose gel electrophoresis setup.

Image from NOAA: Deep Sea Medicines http://oceanexplorer.noaa.gov/explorations/03bio/background/molecular/media/gel_plate.html

The agarose gel is a mesh network of agarose strands, which impede the motion of macromolecules moving under current. Smaller molecules migrate faster since they have more possible paths, and are impeded less by the gel. Consquently, the fragments are separated based on size. The graph shows the relationship between length in bp and distance migrated by a DNA fragment during agarose gel electrophoresis. This relationship is represented by the equation Distance = a - b (log(M)), where M is the molecular weight in kilodaltons.

After the gel has finished running, it can be stained with a DNA-specific stain and visualised under UV light. Note the use of the rightmost lane - a DNA sample with fragments of known lengths is loaded here, so we can estimate our sample fragment sizes.

Knowing the locations of restriction sites lets us predict the fragments seen on a gel

A restriction map is a diagram of the distances between restriction sites. In the example, a 1650 bp fragment has 1 site for SalI, and 2 sites for KpnI. Depending on which enzymes we use to cut the fragment, we can predict the bands that would be seen on a gel. Restriction digests, for example, can be a quick way to verify whether a recombinant plasmid construct made in the lab is correct, before we use it for further experiments.

Caution! Do NOT try to measure the amount of DNA on a gel based on the intensity of fluorescent bands. First, the intensity of the bands on the gel increases in a non-linear fashion with respect to the mass of DNA. Secondly, the quantitaton of fluorescent intensity is also non-linear. While it is possible to measure fluorescent intensity, the gel would have to include a dilution series of fragments of known mass as internal standards.